Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 2521 citations for 7 Octenyldimethylmethoxysilane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Intracellular ROS levels were quantified using the redox-sensitive dye 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Thermofisher Scientific). Exponentially growing PA14 cultures were left untreated or treated with 0.25 µg/ml Gm ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using Power SYBR on the QuantStudio 7 Real-Time PCR System (ThermoFisher Scientific). mRNA expression levels were calculated relative to the housekeeping gene ...
-
bioRxiv - Biophysics 2023Quote: ... The reaction mixture was then transferred to 2 ml ZebaSpin MWCO 7 kD (Thermo Fisher Scientific, USA) columns to separate the labeled protein from the free dye ...
-
bioRxiv - Cell Biology 2022Quote: ... Measurements were performed on an Applied Biosystems ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: The cells were incubated with nonfluorescent cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, 5μM, ThermoFisher Scientific, UK) probe for 30 min prior to ES ...
-
bioRxiv - Genomics 2023Quote: ... HEK-293 cells were co-transfected with Renilla and IRF3/7 using Lipofectamine 2000 (Thermo Fisher scientific) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... beads were prepared with 7-10μg of antibody coupled to M-280 mouse or rabbit Dynabeads (Invitrogen) for 8 hours as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were mounted on microscopy slides using 7 µl ProLong Glass Antifade mounting medium (ThermoFisher Scientific, Invitrogen). The mounting medium was cured for 24 h at RT.
-
bioRxiv - Developmental Biology 2023Quote: ... Zebrafish cDNA was prepared from RNA extracted from AB zebrafish (1–7 dpf) using Trizol (Ambion #15596026) and phenol:chloroform (Millipore #19K0856166) ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... and carried out on an Applied Biosystems Vii 7 RT-PCR system (Thermo Scientific P/N 4453552). Validated gene-specific primers in this study can be found in Table S14 ...
-
bioRxiv - Cell Biology 2023Quote: ... Treated and untreated organoids were collected at day 7 and dissociated to single cells using TrypLE (Invitrogen) incubation at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4T1 and E0771.lmb.PuroR metastasis were cultured for 7-10 days with minimal disturbance in IMDM (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transfected with indicated siRNAs (listed in Supplementary table 7) with the use of Lipofectamine RNAiMAX (Invitrogen), according to manufacturer’s instructions using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resultant reporter construct was transiently transfected into COS-7 cells using Lipofectamine LTX (Thermo Fisher Scientific), together with an internal control vector pGL4.74 (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA from 10 of 7-day-old seedlings was extracted by using TRI reagent (AM9738, Invitrogen). In total ...
-
bioRxiv - Genetics 2023Quote: ... and fluorescence was monitored on ABI ViiA 7 and QuantStudio 5 Realtime PCR system (Applied Biosystems, USA). Melting curve analysis was done for each amplicon ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were dissected from pregnant mice at embryonic day 7.7–7.8 (wild type) or 8.0 (iv/iv) in Dulbecco’s Modified Eagle Medium (DMEM, 12320-032, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2023Quote: ... MCF-7 breast cancer cells were seeded for 24 hours in phenol red-free MEM medium (GIBCO) supplemented with 5% charcoal-stripped calf serum (Atlanta Biologicals) ...
-
bioRxiv - Immunology 2023Quote: ... Relative quantification of genes of interest was performed by qPCR analysis using QuantStudio Pro 7 system (ThermoFisher) and PowerTrack SYBR Green master mix (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were resuspended in PBS with 7 μg/ml DAPI and measured on an Attune (Thermo Fisher). Data were analyzed using FlowJo software version 10.7.0.
-
bioRxiv - Genetics 2023Quote: ... Single mES cells (7 × 105 cells) were transfected with vectors using Lipofectamine LTX (#15338100; Thermo Fisher Scientific) [DNA ...
-
bioRxiv - Microbiology 2023Quote: ... using a QuantStudio 7 Flex Real-Time PCR System utilizing TaqMan Gene Expression Master Mix (Applied Biosystems).
-
bioRxiv - Immunology 2024Quote: ... Frozen lungs were cut into 7-8 µm sections using a Cryostar NX50 cryostat (Thermo Fisher Scientific) and mounted on silane-treated glass slides (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... Relative quantification of genes of interest was performed by qPCR analysis using QuantStudio Pro 7 system (ThermoFisher) and SYBR Green master mix (ThermoFisher) ...
-
bioRxiv - Plant Biology 2023Quote: ... two guide RNAs targeting the end of exon 6 and the beginning of exon 7 respectively (GAATTCTGCGGCACTATCCA and GATAACAAACTTCTGCTGAC) were designed using CRISPOR (http://crispor.tefor.net/crispor.cgi) and synthesized by Invitrogen GeneArt (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were detected using an Applied Biosystems ViiA 7 Real-Time PCR System (ThermoFisher Scientific). Relative gene expression was determined by the 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF-7 and T47D were purchased from ATCC and were cultured in phenol red–free DMEM (Gibco) with 10% FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... and 10% glycerol) using 0.5-mL Zeba™ spin desalting column (7-kDa MWCO) (ThermoFisher Scientific, #89882). The solution was warmed to room temperature and 5 μL of 5 mg/mL taxol-stabilized MTs was added ...
-
bioRxiv - Immunology 2024Quote: ... and qPCR experiments were completed on a QuantStudio 7 flex real-time PCR system (Applied Biosystems, 4485701) using the Taqman gene expression master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... LLC-MK-2 cells (rhesus monkey kidney; CCL-7/ATCC) were cultured in MEM (GIBCO #11095-080) supplemented with 100 units/ml penicillin and 100 μg/ml streptomycin (P/S) ...
-
bioRxiv - Neuroscience 2023Quote: The brains of 7-day-old flies were dissected in Schneider’s insect medium (Thermo Fisher Scientific, 21720). They were then fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS ...
-
Mitochondrial bioenergetics stimulates autophagy for pathological tau clearance in tauopathy neuronsbioRxiv - Neuroscience 2024Quote: ... Non-Tg and PS19 neurons were transfected with various constructs at DIV5-7 using Lipofectamine 2000 (Invitrogen) followed by time-lapse imaging 10-14 days after transfection prior to quantification analysis.
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Bioengineering 2024Quote: ... and passaged every 7 days by treatment with TrypLE Select Enzyme (Thermo Fisher Scientific Inc., MA, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... Reactions were run and data analyzed using the QuantStudioTM 7 Flex Real-time PCR system (Applied Biosystems). Data were calculated using the 2-△△Ct method.
-
bioRxiv - Bioengineering 2024Quote: ... Herceptin was buffer exchanged in PBS by using 7 K MWCO Zeba Spin Desalting Columns (ThermoFisher Scientific). Then it was incubated with 20ME (Molar equivalent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were split every 7 days using 5-minute incubation with 0.5 mM EDTA-PBS (Thermo Fisher) at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... the proteins were transferred to nitrocellulose membranes using the iBlot 7-min blotting system (Thermo Fisher Scientific). Membranes were blocked for 1 h at room temperature in 1 x casein blocking buffer (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... upon which 1 μg of yeast RNA and 10× structure buffer (0.1 M Tris at pH 7, 1 M KCl, 0.1 M MgCl2; Ambion) were added ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cultured neurons were transfected at 7 days in vitro (DIV) with a commercial calcium phosphate transfection kit (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and qPCR was performed using let-7 and 2S rRNA TaqMan MicroRNA Assay primer mix (Thermo Fisher Scientific) with the TaqMan Small RNA Assay (Applied Biosystems).
-
bioRxiv - Neuroscience 2021Quote: ... Larval zebrafish at 6-7 dpf were paralyzed by immersion in 1 mg/ml alpha-bungarotoxin solution (Invitrogen) dissolved in external solution (in mM ...