Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 2844 citations for 8 Bromoguanosine hydrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lysates were separated by SDS-PAGE electrophoresis (NuPAGE 3-8%TRIS acetate protein gels (Invitrogen) or 4-20% Mini-PROTEAN TGX protein gel (Bio-Rad)) ...
-
bioRxiv - Immunology 2023Quote: ... IPs and total cell extracts were analyzed by NuPage 3-8% Bis-Tris gel (Invitrogen Novex), transferred onto PVDF membrane (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: 1 x 107 cells at the exponential growth phase were labeled with 8 µM CFSE (Invitrogen) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... Knockdown experiments were transfected with 8 pmol siRNA (Scramble: AM4635, PLD1: 4390824, ThermoFisher, Waltham, MA, USA) and 0.4 µL Lipofectamine 2000 per well for 72 hours prior to imaging.
-
bioRxiv - Bioengineering 2024Quote: ... We then deposited the microspheres on an 8-well chambered coverglass (12-565-470, Fisher Scientific) to match the imaging conditions of the cellular samples.
-
bioRxiv - Genomics 2024Quote: ... Cells were washed twice with PBS and then incubated with 8 µM of DHE (Thermo Fisher) in serum-free DMEM for 15 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... H292 cells were plated in Nunc Lab-Tek 8-chambered coverglass (Thermo Fisher Scientific, Rochester, NY) and allowed to adhere ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×103 cells/well were seeded in 8-well chamber slides (Nunc Lab-Tek, Thermo Fisher) and cultured overnight in growth medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×103 cells/well were seeded in 8-well chamber slides (Nunc Lab-Tek, Thermo Fisher) and cultured overnight in growth medium ...
-
bioRxiv - Immunology 2024Quote: ... H292 cells were plated in Nunc Lab-Tek 8-chambered coverglass (Thermo Fisher Scientific, Rochester, NY) and allowed to adhere ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The reaction product was diluted 8-fold with 0.1×TE Buffer pH 8.0 (12090-015, Invitrogen). The PCR reactions were conducted using TaqMan Universal Master Mix II (4440040 ...
-
bioRxiv - Neuroscience 2024Quote: ... frozen in blocks of 4-8 cords/block in Shandon M1 Embedding Matrix (1310; Fisher Scientific), and cut in the sagittal plane at 20.0 µm thickness at -16°C on a cryostat ...
-
bioRxiv - Cancer Biology 2024Quote: 4,000 DAOY cells/well were plated in 8-well chambered glass slides (Nunc Lab-Tek II) and reverse transfected with siRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were washed with 8 mL of PBS and harvested with 0.05% Trypsin-EDTA (GIBCO). The trypsinized cells were resuspended in 9 mL of DMEM and added to a 15 mL centrifuge tube ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant proteins were purified under denaturing conditions (8 M urea) using Ni-NTA resin (Thermo Scientific). The purity of the recombinant proteins was assessed via SDS-PAGE ...
-
bioRxiv - Microbiology 2024Quote: ... and FadL samples were resolved on 8-16% Tris-glycine minigels (Thermo Fisher, catalog number XP08165BOX), and assembly was determined by Western blotting using an appropriate antiserum and the IR Dye 680LT goat anti-rabbit secondary antibody (LI-COR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Gene fragments were resuspended to 10 ng/µl in 10 mM Tris-HCl pH 8 (Invitrogen). Each DNA template for transcription of 1,799 nt RNA segments ...
-
bioRxiv - Microbiology 2024Quote: Simplified model matrices consisted of a roughly physiological NaCl concentration (8 g/l; ThermoFisher Scientific, 207790010) and proteins of different sizes in milli-Q water ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 days after transduction and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2021Quote: ... spheres were rinsed with PBS and placed into 8-well chambers (Nunc Lab-Tek, Thermo Scientific, USA) with plasma cleaned glass coverslip (MENZEL-Gläser Deckgläser 24 × 60 mm #1.5 ...
-
bioRxiv - Biophysics 2021Quote: ... spheres were rinsed with PBS and placed into 8-well chambers (Nunc Lab-Tek, Thermo Scientific, USA) with plasma cleaned glass coverslip (MENZEL-Gläser Deckgläser 24 × 60 mm #1.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of protein were loaded into 8% Bolt™ Bis-Tris Plus gels (Life Technologies, #NW00085BOX), separated by SDS-PAGE and then transferred to PVDF membranes ...
-
bioRxiv - Cancer Biology 2021Quote: SK-N-BE(2) and NB16 cells were seeded into 8-champer slides (Thermo Fisher Scientific, 154534) with a density of 6×103 cells/well overnight and treated with indicated treatment for 72h ...
-
bioRxiv - Cell Biology 2020Quote: ... 3×104 hTERT-RPE cells expressing mKO2-PACT were seeded into 8 well glass bottom dishes (Nunc™ Lab-Tek™ II Chambered Coverglass ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were grown in 8-well chamber slides (Nunc Lab-Tek chamber slide system, Thermo Scientific), washed and treated with 30-50 μM hydroxychloroquine for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50µl of RNA samples were pipetted into Axygen PCR 8-strip tubes (Fisher Scientific 14-222-252) and processed through PrepX protocols on the Apollo liquid handling system ...
-
bioRxiv - Developmental Biology 2021Quote: ... Ten μg of lysate was subjected to SDS-PAGE on an 8–16% Tris-glycine gel (ThermoFisher), followed by electroblotting onto an Immobilon PVDF membrane (EMD Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... double-stranded oligonucleotides containing eight BMP-responsive elements in tandem (8×BRE; AGATCCTCTGGTCACAGGATAATAATCCTGACGCCAGAAAGTCTGGAGGTC) were synthesized (GeneArt, Invitrogen) and introduced into the pNL3.2[Nluc_minP] vector (Promega) ...
-
bioRxiv - Pathology 2022Quote: ... as reported previously.8 Total RNA was reverse transcribed into cDNA using random primers (Thermo Fisher Scientific). Real-time PCR reactions were performed using a QuantStudioTM 12K Flex Real-Time PCR System with TaqMan Universal PCR Master Mix and TaqMan Gene Expression Assays (probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein samples were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) (3-8% gradient gels, Invitrogen) and subsequently transferred onto nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: 8 TMT reagents from a 10-plex reagent kit were used to label desalted peptides (Thermo Fisher) as directed by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (male WTC11 background77) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific, Waltham, MA, US). One μg of rhPRG4 or 22 ng CG (for endogenous CG assay ...
-
bioRxiv - Biophysics 2019Quote: ... then dissected into ~1 mm3 pieces and solubilised in 100 μL of 8 M urea (Fisher Scientific), or 3 M NaCl (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transferred into 200 µl of fresh medium in an 8-well chamber slide (Nunc(tm) Lab-Tek(tm ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mouse aortic root specimens were cut into 8 μm sections using a freezing microtome (Thermo Scientific). Some sections of aortic root were stained by oil-red O to investigate atherosclerotic lesion ...
-
bioRxiv - Bioengineering 2019Quote: ... The solution was transferred to dialysis membranes (12,000 - 14,000 molecular weight cutoff, Fisher Scientific 21-152-8), dialyzed for 1 week against DI water to remove salts and excess methacrylic acid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with virus containing scrambled control or targeting MTR and Polybrene (8 ug/mL, Invitrogen). Cells were split after 48 h into standard RPMI-media (10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: 10,000 cells were seeded per well into an 8-well Lab-Tek II chambered coverglass slide (Nunc) 48 h prior to imaging ...
-
bioRxiv - Plant Biology 2019Quote: ... The reactions were aliquoted in 100 µL MicroAmp Fast 8-tube strips (ThermoFisher Scientific, Whaltam, MA, USA), frozen at −20°C and then lyophilized for 60 to 90 minutes in a Freezone 2.5 Liter freeze-drier (Labconco ...
-
bioRxiv - Biochemistry 2021Quote: ... The purity and concentration of p300-FLAG were assessed by 8% SDS-PAGE using BSA standards (ThermoFisher) and by western blot with an anti-FLAG antibody (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... seeded at 1.5 x 105 neurons per coverslip in Neuron Medium (8 % FBS, 2 % B-27, [Gibco, 17504-044] ...
-
bioRxiv - Cancer Biology 2020Quote: ... they were re-plated in Lab-Tek II 8-well chambers (Thermo Fisher Scientific, Waltham, MA, USA) and then treated with the appropriate drug (DMSO or TMZ 50 µM ...
-
bioRxiv - Plant Biology 2021Quote: ... 50 mM Tris-Cl at pH 8 and treated with proteinase K (100 μg/ml) (Ambion, USA) for 1 h at 55 °C ...
-
bioRxiv - Cell Biology 2021Quote: Human iPSCs (male WTC11 background24) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: DH1017.IgM was run under non-reducing conditions using a NuPAGE 3-8% Tris-Acetate Gel (Invitrogen) with 1x Tris-Glycine Native Running Buffer (Novex ...
-
bioRxiv - Neuroscience 2020Quote: ... 8 sections regularly sampled across the entire dorsal striatum were mounted on SuperFrost Plus slides (Fisher Scientific) and processed exactly as described in the RNAscope assay online protocol (ACD ...
-
bioRxiv - Molecular Biology 2020Quote: ... EndoC-βH1 cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Molecular Biology 2020Quote: Human β-cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then harvested and stained for 1h at room temperature with 8 μM CCF4-AM (Invitrogen) in EM medium supplemented with 2.5 μM probenecid ...