Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for 6 FLUOROCHROMANO 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Microbiology 2019Quote: ... in which one uninfected male and one uninfected female were introduced in an arena (Petri Dishes 100 x 150 mm, Fisher Scientific, Ontario, Canada). For the second treatment ...
-
bioRxiv - Microbiology 2023Quote: ... were used as template in a one-step RT-PCR reaction with the SuperScrip IV One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) and primers that amplify coding sequences for Spike amino acids 614 and 655 (Table 2) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the RNA concentration was measured by UV spectroscopy (NanoDrop One Microvolume UV-Vis Spectrophotometer, ND-ONE-W, Thermo Fisher Scientific, Waltham, MA). Reverse transcription was performed using the iScript cDNA Synthesis Kit (1708891 ...
-
bioRxiv - Microbiology 2023Quote: ... An 800 bp fragment covering the ORF10 region was amplified by one-step RT-PCR using the SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) and the following primers (OL11F ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then dipped in the secondary antibody-containing buffer with the nuclear dye 4′,6-diamidino-2-phenylindole (DAPI, Cat# D1306, Life Technologies-Invitrogen, Carlsbad, CA, USA, dilution 1:400), for 2 hours at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution, “CM-113” program) and plated on a feeder layer of irradiated CF1 MEFs (Thermofisher, 4×106 MEFs per 6 well plate) at 8×g104 nucleofected cells per well ...
-
Probing Interactions of Therapeutic Antibodies with Serum via Second Virial Coefficient MeasurementsbioRxiv - Biophysics 2021Quote: ... Labeling efficiency was determined through UV-Vis spectroscopy (A280 and A494 measurements) on a Nanodrop One Microvolume Uv-Vis spectrometer (Thermo Scientific, ND-ONE-W) as well as through diffusion time (change from free dye to protein-bound dye) ...
-
bioRxiv - Immunology 2023Quote: ... DNA pellet was resuspended in TE buffer (10mM Tris HCl, 1mM EDTA, pH 7.5) and quantified using a NanoDrop™ One/One from Thermo Fisher (Waltham, MA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2020Quote: ... then transformed into One Shot TOP10 competent cells (ThermoFisher Scientific). Each mutant construct was sequenced to ensure that no unintended mutations were introduced ...
-
bioRxiv - Biochemistry 2022Quote: ... one lane was dedicated to the prestained marker (Thermo Scientific™ PageRuler™ Plus Prestained Protein Ladder ...
-
bioRxiv - Molecular Biology 2021Quote: ... One hundred microlitre 3,3′,5,5′-tetramethylbenzidine substrate (Thermo Fisher Scientific) was added to each well and incubated for 10-15 min ...
-
bioRxiv - Immunology 2019Quote: ... Greiner Bio-One 96-well plates (Fisher Scientific, Waltham, MA), positioned on a ceramic platform under vacuum ...
-
bioRxiv - Plant Biology 2019Quote: ... coli One Shot®Top10 cells (Invitrogen Corp., Carlsbad, CA) and purified from an overnight culture using DNA Mini prep kit (Qiagen Co. ...
-
bioRxiv - Genetics 2019Quote: ... we ordered one pre-designed probe (Hs04385285_cn) from Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... One microliter of RNase Cocktail Enzyme Mix (Thermo Fisher Scientific) was used to degrade the RNA in the sample ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA were measured (NanoDrop One, Thermo Fisher, Waltham, MA), normalized to 10ng/μL and then reverse transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2019Quote: ... on a Step One Plus Real Time PCR (Applied Biosystems) was performed ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA concentrations were measured using NANODROP ONE (Thermo Fisher Scientific). RNA was reversely transcribed into complementary DNA (cDNA ...
-
bioRxiv - Biophysics 2021Quote: ... Signal was developed using One-step Ultra TMB Substrate (ThermoFisher).
-
bioRxiv - Cancer Biology 2020Quote: ... followed by one wash in phosphate buffered saline (PBS, GIBCO), a red cells lysis step ...
-
bioRxiv - Neuroscience 2020Quote: ... Cloning procedures were done in One Shot Stbl3 (ThermoFisher Scientific) competent cells to minimize recombination events ...
-
bioRxiv - Microbiology 2020Quote: ... with Step One Plus Real-Time PCR system (Applied Biosystems). The 16S rRNA gene was used as an internal reference ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-PCR was performed using SuperScript III (Invitrogen), Platinum Taq HiFi polymerase (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... with one Protease Inhibitor Mini Tablet (Thermo Scientific, EDTA free) per 10mL of resuspension buffer ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was quantified using a Nanodrop One (Thermo Fisher Scientific) before cDNA amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a NanoDrop One Microvolume UV-Vis Spectrophotometer (ThermoFisher, UK) was used to measure the concentration and purity of the pDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Stellar Competent Cells were from Takara and One Shot® BL21 (DE3) Cells were from Invitrogen. All chemicals for buffer preparations were from SigmaAldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... with one wash containing DAPI (1:50000, D3571, Invitrogen, Thermofisher), mounted with mouting media and stored in darkness at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... with one wash containing DAPI (1:50000, D3571, Invitrogen, Thermofisher), mounted with mouting media and stored in darkness at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 50 μL of One Step Ultra-TMB (Fisher Scientific, PI34029) was added to each well and incubated for 5 min before stopping with 4 N sulfuric acid and reading in a BioTek plate reader.
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was quantified using NanoDropTM One/Onec (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... and purity was calculated using a NanoDrop One (Thermo Fisher). Genomic DNA samples (3 µg ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein concentration was estimated using a Nanodrop One (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... DNA purity was determined on the Nanodrop One (ThermoFisher Scientific) and quantified on the Qubit dsDNA fluorometer ...
-
bioRxiv - Immunology 2022Quote: ... using SuperScriptTM III Platinum One-Step qRT-PCR System (Invitrogen) and specific primers and probe (Eurofins) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and analyzed on a Step-One Plus instrument (Applied Biosystems). At least 3 biological repeats were analyzed for each group.