Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for 6 FLUOROCHROMANO 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... tested for purity using the NanoDrop™ One spectrophotometer (ThermoFisher Scientific), and quantified fluorometrically using the Qubit dsDNA High sensitivity kit ...
-
bioRxiv - Genetics 2019Quote: ... on a Step-One Plus Real time PCR system (Applied Biosystems). All reactions were run as follows ...
-
bioRxiv - Microbiology 2019Quote: ... One step RT-PCR kit (Thermo Fisher Scientific, Waltham, MA, USA) on the Applied Biosystems 7500 FAST following the previously described protocols.
-
bioRxiv - Genetics 2019Quote: ... for one hour and subsequently in 10% goat serum (Thermo Fisher) supplemented with 3% Bovine Serum Albumin (BSA ...
-
bioRxiv - Microbiology 2020Quote: ... on the Step One Plus Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Zoology 2021Quote: ... and the absence of contaminants was confirmed with NanoDrop One (ThermoFisher) with target OD 260/280 and OD 260/230 ratios of 1.8 and 2.0-2.2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and One Shot® TOP10 (Thermo Fisher Scientific, Waltham, MA, USA)) chemically competent Escherichia coli according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... on a Step One Plus Real-Time PCR System (Applied Biosystems). Primers were designed to be specific for each gene assay and generated by the DNA services core and IDT Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Skin biopsies were immediately stored in one milliliter of RNALater (Ambion, Thermo Fisher Scientific Inc. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and a Step One Plus Real-time PCR machine (Applied Biosystems). The amounts of mRNA were measured with SYBR Green PCR Master Mix (Ambion) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Step One Plus Real-time PCR system (Applied Biosystems). Data represents two independent experiments with three technical replicates per experiment ...
-
bioRxiv - Biochemistry 2021Quote: ... which was grown in One Shot PIR1 cells (Thermo Fisher Scientific). Plasmids were purified using the GeneJET plasmid miniprep kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-Time PCR System using Step One software v2.0 (Applied Biosystems). All qRT-PCR reactions were performed in duplicate ...
-
bioRxiv - Cancer Biology 2021Quote: ... One-Step™ Turbo TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to the wells for color development ...
-
bioRxiv - Immunology 2021Quote: ... using three Dynabeads per one Treg cell (Thermo Fisher Scientific, USA) for activation ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentrations and purity were assessed using a NanoDrop One (ThermoFisher). Samples with A260/A280 ratio < 2 were subjected to further DNAse treatment using DNAse I ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 10% One Shot dialyzed FBS (Thermo Fisher A33820-01), 1mM sodium pyruvate (Gibco 11360-070) ...
-
bioRxiv - Molecular Biology 2022Quote: ... One volume of 1X Tris-EDTA buffer (pH 7.5; Invitrogen, 15567027) and 0.3X room temperature SPRI beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene expression was quantified using One-Step qRT-PCR Kits (Invitrogen) in the Applied Biosystems Step One Plus Real-Time PCR System ...
-
bioRxiv - Molecular Biology 2022Quote: One microgram of total RNA extracted using the Trizol reagent (Invitrogen) was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nucleic acids concentrations were determined with a Nanodrop One (Thermo Scientific), and 50 ng of product was used to prepare TGIRT-seq libraries for high-throughput sequencing.
-
bioRxiv - Microbiology 2022Quote: ... using a SuperScript III One-Step RT-PCR Kit (Invitrogen, Germany). Reverse transcription of the viral RNA and amplification of the cDNA was conducted in a LightCycler 480 System (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... One µg aliquots of RNA were digested with DNaseI (Thermo Scientific), and reverse transcribed by using RevertAid reverse transcriptase (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality and concentration were assessed using a Nanodrop One (ThermoFisher). Reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was quantified using NanoDrop One (Thermo Fisher Scientific, Madison, USA). The selective amplification of 16S rDNA gene was performed using bacterial universal primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... Concentrations of shRNA was measured with a NanoDrop One (Thermo fisher).
-
bioRxiv - Bioengineering 2022Quote: ... one droplet of NucBlue™ Hoechst 33342 (R37605, Thermo Fisher Scientific) was added per scaffold to visualize all cell nuclei and samples were incubated at 37 °C for 20 min ...
-
bioRxiv - Neuroscience 2022Quote: ... We used the Taqman one-step qRT-PCR (Invitrogen 11732-020) in a final volume of 12.5 μL per reaction in 384-wells PCR plates using a thermocycler (QuantStudio 6 Flex ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was quantified using One-Step qRT-PCR Kits (Invitrogen) in the Applied Biosystems Step One Plus Real-Time PCR System ...
-
bioRxiv - Immunology 2023Quote: ... one was labeled with a Zenon IgG labeling kit (ThermoFisher Scientific) using AlexaFluor fluorochromes ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was quantified using the NanoDrop One (Thermo Scientific, USA) and Agilent Tape Station ...
-
bioRxiv - Physiology 2023Quote: ... One-to-two drops of SlowFade Diamond Antifade Mountant (Invitrogen S36963) were added ...
-
bioRxiv - Neuroscience 2023Quote: In vivo samples: One ml of cold TRIzolTM Reagent (Invitrogen, #15596026) was added to each tissue sample and homogenized using a TIssueLyzer II (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Developmental Biology 2023Quote: ... on a Step One Plus Real-Time PCR machine (Applied Biosystems). The following program was used ...
-
bioRxiv - Microbiology 2023Quote: ... one primer was 5’ phosphorylated using a T4 Polynucleotide Kinase (ThermoFisher) using recommended reaction conditions ...
-
bioRxiv - Immunology 2023Quote: ... Eluted DNA was quantified on the NanoDrop One (Thermo Fisher Scientific) and diluted to the same concentration ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain was BL21(DE3) from Invitrogen (One ShotTM BL21(DE3), Cat ...
-
bioRxiv - Biochemistry 2023Quote: ... Concentration of all plasmids was measured by NanoDrop One (Thermo Scientific) and the plasmids were stored at −80°C.
-
bioRxiv - Biochemistry 2023Quote: ... purified RNA was quantified using a NanoDrop One spectrophotometer (Thermo Fisher). 500 ng of total RNA were reverse-transcribed using M-MLV reverse transcriptase (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA concentration was measured using a NanoDrop One (Thermo Fisher Scientific). A minimum threshold of 10 ng/μL was required to proceed with reverse transcription ...
-
bioRxiv - Cell Biology 2022Quote: One hour of 1 mg/ml collagenase (Therm Fisher Scientific, 17104019) treatment was used to detach iPSC colonies ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA concentration was quantified using a NanoDrop One (Thermo Scientific). Equal amounts of RNA were treated with RQ1 DNase (M610A ...
-
bioRxiv - Genomics 2022Quote: ... RNA concentrations were measured using a NanoDrop One spectrophotometer (ThermoFisher Scientific). 1 μg of RNA was used to synthesize cDNA with First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... one mini tablet of protease and phosphatase Inhibitor (# A32959, Thermo Fisher) was added to 10 ml of ice-cold N-PER Neuronal Protein Extraction Reagent (# 87792 ...
-
bioRxiv - Immunology 2023Quote: ... and a Superscript III Platinum One-Step qRT-PCR System (ThermoFisher). Primers and reporter probe bind to the LTR and their sequences are GCTAGACTCTCACCAGCACTTG (forward) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All siRNAs but the ones against MdmX were purchased from Ambion and transfection was done using Lipofectamine RNAiMax transfection reagent (cat.#13778150 ...
-
bioRxiv - Immunology 2022Quote: ... clear-bottom 96-well plates (Thermo Fisher or Greiner Bio-One) at a density of 20,000 cells per well one day before the assay (day 0) ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Step One Plus Real-Time PCR System (Applied Biosystems) and the following TaqMan primer sets ...
-
bioRxiv - Immunology 2024Quote: ... SuperScript™ III One-Step RT-PCR (ThermoFisher Scientific, Waltham, MA) was used according to the manufacturer’s instruction to amplify Mu Mx1 RNA using Mu Mx1 specific primers ...