Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed in the 7500 Real Time PCR System (Applied Biosystems). The relative fold gene expression of HMX3 was calculated with the delta-delta Ct approach ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA assessed by quantitative RT-PCR using Taqman reagents (all Applied Biosystems) on a QuantStudio 7 Real Time PCR cycler with Hprt/HPRT1 as an internal mRNA control.
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative RT-PCR was performed using Power SYBR Green Master Mix (Applied Biosystems). Results were normalized using 18S ribosomal RNA (rRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed using a ViiA7 real-time PCR system (Applied Biosystems). All probes were TaqMan “Best coverage” probes (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... AML cell lines U937 (FLT3-negative, miR-155low) and HL60 (FLT3-WT, miR-155low)(24, 25) were maintained in minimum essential medium-α medium (Gibco, Carlsbad, USA). MOLM-14 (FLT3-ITD+ ...
-
bioRxiv - Evolutionary Biology 2024Quote: Total RNA was extracted from L3 larvae and pre-pupae of miR-277-KO and miR-34-KO flies using TRIzol® Reagent (Thermo Fisher Scientific) and sequenced on Illumina HiSeq platform ...
-
Fetal estrogens are not involved in sex determination but critical for early ovarian differentiationbioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR was performed on reverse transcribed RNAs (High Capacity Reverse cDNA Transcription kit with the included set of random primers, Applied Biosystems, ThermoFisher, France). Several PCR sets of primers and analyses were those published previously (Daniel-Carlier et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fabp4 and Cebpa) and beiging (Ucp1, Cox 8a, Cox7, Cidea, and Prdm16) genes using appropriate primer sets and Prism 7900-HT (Applied Biosystems Inc.) (56).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA was extracted from isolated whole femur for qPCR for osteoblast (Col1a1, Alpl, Runx2 and Bglap) and osteoclast (Acp5) genes using appropriate primer sets using Prism 7900-HT (Applied Biosystems Inc.) (56).
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... was performed using Taqman reagents and specific primer and probe sets for human SLC22A24 (Assay ID: Hs00543210_m) and GAPDH (Assay ID: Hs99999905_m1) (Applied Biosystems, Foster City, CA). Reactions were performed in a 96-well plate with a 10 µL reaction volume using an ABI 7900HT Fast Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed on reverse transcribed RNAs (High Capacity Reverse cDNA Transcription kit with the included set of random primers, Applied Biosystems, ThermoFisher, France). Based on the output of the GeNorm program ...
-
bioRxiv - Molecular Biology 2022Quote: ... and qPCR was performed with gene-specific primer sets (Supplemental Table S6) and PowerUp™ SYBR™ Green Master Mix (Applied Biosystems). All qPCR analyses were carried out on an Applied Biosystems QuantStudio 7 Flex Cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA products were diluted 1:1 and 2 µL was analyzed by qPCR using custom primer sets and PowerUp SYBR Green Master Mix (10 µL total reaction, Applied Biosystems # A25742). RT-qPCRs were performed on a Quantstudio3 from Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative RT-PCR was performed using Taqman PCR Master Mix and Gene Expression Assays (Applied Biosystems, Supplementary Table 1) in triplicate for each sample and each gene ...
-
bioRxiv - Immunology 2019Quote: ... and real-time PCR was performed with SYBR green and a StepOne Plus RT-PCR system (both Applied Biosystems). Reactions were performed in duplicate or triplicate ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed for the selected genes using Taqman® assays (Life Technologies) on LDA cards ...
-
bioRxiv - Pathology 2019Quote: ... Real-time RT-PCR was performed using the SuperScript III Platinum One-step qRT-PCR kit (Life Technologies, UK). The final mastermix (15 μl ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative Real-Time PCR (q-RT-PCR) was performed using SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific) and the ViiA 7 Real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2020Quote: ... Quantitative real-time RT-PCR was performed on a ViiA™ 7 Real-Time PCR System (Applied Biosystems Inc.) The PCR program was ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR analysis was performed using the ABI Prism HT 7900 real time PCR detection system (Applied Biosystems) equipped with SDS software version 2.4 (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2022Quote: ... Real-time RT-PCR was performed using a StepOne real time PCR system (Thermo Fisher Scientific, Grand Island, NY) using the Taqman Universal PCR Master Mix (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... the qRT-PCR was performed using SuperScript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA, USA) on a LightCycler 480 or LightCyc instrument (Roche Diagnostics ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The obtained RNA was reversed-transcribed and PCR-amplified using the Superscript III One Step RT-PCR system (Invitrogen) followed by an additional error-prone PCR step (20 cycles ...
-
bioRxiv - Plant Biology 2020Quote: ... and quantitative RT-PCR was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA) using SYBR Green ...
-
bioRxiv - Neuroscience 2020Quote: ... Real time RT-PCR reaction was carried out using Syber green 2X Universal PCR Master Mix (Applied Biosystems, USA) in ABI Prism 7500 sequence detection system ...
-
bioRxiv - Immunology 2020Quote: ... PCR was performed using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher Scientific) as per manufacturer’s instructions with the addition of 2 μl MgSO4 ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR was then conducted using the Quantifast SYBR Green PCR Kit and a StepOnePlus thermal cycler (Applied biosystems) with the following thermal profile ...
-
bioRxiv - Physiology 2020Quote: ... Quantitative real-time PCR was performed using the TaqMan Gold RT-PCR kit and ABI Prism 7700 (Applied Biosystems) sequence-detection system ...
-
bioRxiv - Microbiology 2021Quote: ... The VP1 region was amplified by RT-PCR and PCR products were cloned using TOPO-TA Cloning Kits (ThermoFisher) (Primers used ...
-
bioRxiv - Genomics 2021Quote: ... The taqman based q-RT-PCR was performed using the TaqMan Fast Universal PCR Master Mix (2X, Applied Biosystems) and ‘Fam (Fluorescein ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Quantitative RT– PCR was performed using the QuantStudio-6 and -7 Flex Real-Time PCR Systems (Thermo Fisher Scientific) with SYBR® Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative RT-PCR was conducted in 7900HT Fast Real-Time PCR using SYBR Green Master Mix from Thermo Scientific TM ...
-
bioRxiv - Immunology 2024Quote: ... and the RT-PCR reaction was performed using a Quant Studio 5 Real-Time PCR Instrument (Applied Biosystems, MA). For quantification ...
-
bioRxiv - Pathology 2023Quote: ... Real-time RT-PCR was performed using a StepOne real time PCR system (Thermo Fisher Scientific, Grand Island, NY) using the Taqman Universal PCR Master Mix (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative RT-PCR was performed on a ViiA 7 Real-Time PCR System with OptiFlex Optics System (Applied Biosystems) using PowerUp SYBR Green PCR kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription quantitative PCR (RT-qPCR) was run on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific) with TB Green Advantage qPCR premix (Takara Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time RT-PCR was performed using a reverse transcription kit and real-time PCR kit (Applied Biosystems, USA) with three replicates ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time RT-PCR was performed using a reverse transcription kit and real-time PCR kit (Applied Biosystems, USA). The following primers were used.
-
bioRxiv - Cancer Biology 2020Quote: ... Relative miRNA expression between stem and differentiated samples was assessed via RT-qPCR with the miRCURY LNA™ Universal RT microRNA PCR system (Exiqon) and a StepOnePlus thermocycler (Applied Biosystems). The following miRNA LNA qpcr primer sets (Exiqon ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-qPCR was performed using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (12574-026, Invitrogen). Each 25 μL reaction contained 5 μL of sample ...
-
bioRxiv - Microbiology 2021Quote: RusV-specific RNA was detected by TaqMan RT-qPCR using the AgPath-ID One-Step RT-PCR reagents (Thermo Fisher Scientific, Germany) along with a modified primer/probe set targeting the p200 ORF 2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-qPCR analysis was performed using Power SYBR™ Green RNA to CT™ 1 step RT-PCR kit (Applied Biosystems, #4389986) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: Quantification of the N gene in the eluate was performed by real-time reverse-transcription (RT-qPCR) using SuperScript™ III Platinum™ One-Step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (26) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of extracted RNA samples were determined in one-step RT-qPCR using AgPath-ID one-step RT-PCR (Applied Biosystems, UK) with the following cycle conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was performed using the RT-PCR Kit (Seven, Beijing, China) on the Quant Studio 3 (Thermo Fisher Scientific, Massachusetts, USA), according to the manufacturer’s procedures ...
-
bioRxiv - Cancer Biology 2023Quote: Transcript levels were measured using quantitative RT-PCR by reverse transcribing total RNA to cDNA (Maxima H Minus RT, Thermo Fisher Scientific), then using fast SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... primers against the V3–V4 hypervariable region of the 16S gene (CCTAYGGGRBGCASCAG forward primer; GGACTACNNGGGTATCTAAT reverse primer).41 PCR was done using AmpliTaq Gold 360 master mix (Life Technologies, Mulgrave, Australia) following a two-stage PCR protocol (29 cycles for the first stage ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of CRK2 was amplified by PCR (forward primer: ATGAAGAAAGAACCTGTCC, reverse primer: TCTACCATAAAAGGAACTTTGTGAG) and inserted into pDONRzeo (Invitrogen; Thermo Fisher Scientific), then transferred to the pBm43GW (Invitrogen ...
-
bioRxiv - Plant Biology 2019Quote: ... The promoter region of CRK2 was amplified by PCR (forward primer: GGTTTTAGATCGTGTTAGATATATCA, reverse primer: TTTGTTTTGTTTGATTGAGAAA) and inserted into pDONR4R1 (Invitrogen; Thermo Fisher Scientific), then transferred to pBm43GW ...