Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The FCM antibody panel and gating strategy are detailed in Supplemental Figure 1.33 CD81 mRNA was quantified by Taqman RT-PCR and GAPDH normalized (CD81: Hs00174717_m1, GAPDH: Hs03929097_g1, StepOnePlus Real-Time PCR System, ThermoFisher).
-
bioRxiv - Genetics 2024Quote: ... was used and quantitative RT-PCR was performed on QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific). Gapdh was used as the internal control ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ng of RNA was reverse transcribed using random primers and SuperScript II RT-polymerase (Invitrogen, Carlsbad, CA). Primers were designed using the Primer Express oligo design program software (Applied Biosystems ...
-
bioRxiv - Systems Biology 2021Quote: Barcode-drug mixtures for the valve module were prepared by diluting barcoded RT primers in FreeStyle media (ThermoFisher) to 1 µM ...
-
bioRxiv - Immunology 2022Quote: ... Total cDNA was generated from 1-2 µg of RNA using random hexamer primers and Revertaid RT (Thermofisher). Taqman qPCR was used to quantify LT mRNA levels with normalization to TATA-Box Binding protein and compared to a standard curve to determine copy number (Maru et al. ...
-
bioRxiv - Microbiology 2023Quote: cDNA was prepared from 2 μg RNA using random hexamer primers and SuperScript IV Reverse Transcriptase (RT; Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with miR-1253 Pre-miR miRNA Precursor (Assay ID #PM13220) or scrambled Pre-miR miRNA Precursor negative control #1 (Catalog #AM17110) (ThermoFisher, Waltham, MA). Mimics were transfected with Lipofectamine 2000 (ThermoFisher).
-
bioRxiv - Physiology 2020Quote: ... as well as non-specific negative control oligonucleotides (5′-AAATGTACTGCGCGTGGAGAC-3′) were cloned into pcDNA6.2-GW/EmGFP-miR [“BLOCK-iT™ PolII miR RNAi Expression Vector Kit” (Invitrogen, Darmstadt, DEU). Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2019) or Psi-Check-2-pri-miR-17-92a plasmid in combination with 20pmol miR-21 mimic (Applied BiosystemsTM, Thermo Fisher, Australia), Let-7a mimic (Applied BiosystemsTM ...
-
bioRxiv - Microbiology 2020Quote: Quantitative Taqman real-time PCR (qPCR) was performed in duplicate on RT- and RT+ cDNA using 4x Taqman Fast Advanced Master mix (Applied Biosystems) on a 7500 Taqman PCR system ...
-
bioRxiv - Cell Biology 2020Quote: ... One µg of total RNA was retrotranscribed into complementary cDNA using an RT-PCR kit (High capacity cDNA rt Kit, Applied Biosystems). Quantitative PCRs were carried out in triplicate of each sample using 40 ng of cDNA per well ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR reactions were performed from in vitro cultivated samples with 50ng +RT and –RT cDNA using a ViiA 7 Real-Time PCR system (Applied Biosystems) and Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... Real-time RT-PCR (RT-qPCR) characterization of Mlh3 splicing in mouse tissues was performed with TaqMan Gene Expression Assays (Applied Biosystems) following the manufacturer’s protocol on the CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected by an E-gene based RT-qPCR (27) using the AgPath-ID-One-Step RT-PCR kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription (RT) was performed on 100 ng total RNA using SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen). Quantitative PCR was performed on 2 µl RT sample diluted 10-fold using SYBR Green PCR Master Mix (APPLIED ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time quantitative PCR (RT-qPCR) analysis was then performed using TaqPath one-step RT-qPCR Master Mix (Applied Biosystems, Inc) and ...
-
bioRxiv - Systems Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) analysis was then performed using TaqPath one-step RT-qPCR Master Mix (Applied Biosystems, Inc) and ActinB CTRL Mix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... oligonucleotide primers or PCR products were phosphorylated with T4 polynucleotide kinase (Thermo Scientific). Plasmid assembly was performed by ligation with T4 DNA ligase (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers and probes for qRT-PCR expression analysis were purchased from Applied Biosystems (TCF4 ...
-
bioRxiv - Bioengineering 2020Quote: ... and specific primers on an Applied Biosciences ViiA7 Real-Time PCR System (Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative PCR were assayed using Mus musculus primers against Vegfa (Mm00437306_m1, ThermoFisher), Nos3 (Mm00435217_m1 ...
-
bioRxiv - Cell Biology 2022Quote: ... An ABI 7900HT Fast Real-Time PCR system and custom synthesized primers (Invitrogen) were used to amplify cDNA of target genes by quantitative PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... using gene-specific primers and Power SYBR Green PCR Master Mix (Applied Biosystems). Expression of each gene was normalized to GAPDH ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative PCRs were performed using mouse-specific TaqMan primers and probes (Applied Biosystems) recognizing Neurog3 (Mm00437606_s1) ...
-
bioRxiv - Bioengineering 2019Quote: ... and custom-designed qRT-PCR primers (Table S1; Life Technologies, Grand Island, NY). Transcript levels were normalized to GAPDH and gene expression was calculated as fold-change using the comparative CT method (63).
-
bioRxiv - Neuroscience 2021Quote: ... MiRNA assays by real time PCR was performed using specific Taqman primers (Invitrogen). U6 snRNA was used as an endogenous control ...
-
bioRxiv - Plant Biology 2022Quote: ... with gene-specific primers (Supplementary Table 4) in StepOnePlus PCR system (Applied Biosystems) with StepOne software (v2.2.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR was performed using individually indexed 96-well M13 forward primers (Life Technologies) and a non-indexed M13 reverse primer (5’-GTAACATCAGAGATTTTGAGACAC-3’) ...
-
bioRxiv - Physiology 2023Quote: ... and primers by 7500 Fast real-time PCR System (Thermo Fisher Scientific, USA). qPCR conditions for all reactions included an initial 20 seconds denaturation step at 95℃ ...
-
bioRxiv - Cell Biology 2022Quote: ... and primers on a Quantstudio 5 Real-Time PCR System (Thermo Fisher Scientific). β-actin (Actb ...
-
bioRxiv - Biochemistry 2023Quote: ... and genotyped with a three-primer PCR using PHIRE polymerase (Thermo Fisher Scientific) with primers gCBA1.fwd ...
-
bioRxiv - Cell Biology 2023Quote: ... and corresponding primers in the QuantStudio 3 Real-Time PCR System (Applied Biosystems) and analyzed using QuantStudio software (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μl random primers (50 ng/μl, Thermo Fisher, PCR-545-020T) at 65°C for 5 minutes and then chilled on ice ...
-
bioRxiv - Immunology 2023Quote: ... miRNA levels were measured by real-time PCR using specific TaqMan primers (Invitrogen). U6 small nuclear RNA (snRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... utilizing gene-specific PCR primers mixed with Power SYBR Green Master Mix (ThermoFisher) and diluted cDNA as a template ...
-
bioRxiv - Physiology 2024Quote: ... or primers and SYBR Green PCR Master Mix (Thermo Fisher Scientieic, Waltham, MA). Targets were amplieied using a Quant Studio ViiA7 Real-Time PCR System ...
-
bioRxiv - Microbiology 2023Quote: ... Barcoding PCR reactions were set up as a single 50 μl reaction using the DreamTaq PCR Master Mix (Thermo Fisher Scientific, USA), with 0.8 μmoles of each used barcoding primer and 10 μL of purified and normalised first-step PCR product as template ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of CRK2 was amplified by PCR (forward primer: ATGAAGAAAGAACCTGTCC, reverse primer: TCTACCATAAAAGGAACTTTGTGAG) and inserted into pDONRzeo (Invitrogen; Thermo Fisher Scientific), then transferred to the pBm43GW (Invitrogen ...
-
bioRxiv - Plant Biology 2019Quote: ... The promoter region of CRK2 was amplified by PCR (forward primer: GGTTTTAGATCGTGTTAGATATATCA, reverse primer: TTTGTTTTGTTTGATTGAGAAA) and inserted into pDONR4R1 (Invitrogen; Thermo Fisher Scientific), then transferred to pBm43GW ...
-
bioRxiv - Microbiology 2024Quote: ... Transformants were screened by colony PCR using Bd37 internal primer Bd37-SQF1 (supplement table1) and vector specific primer pBAD-Reverse (Thermo Fisher scientific). Plasmids were purified by using Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... The designed primers were analyzed for their specificity by In-Silico PCR in UCSC In-silico PCR online bioinformatics tool and the primer characteristics were analyzed in a multiple primer analyzer (Thermo Scientific, USA) for the possibility of primer dimer formation ...
-
bioRxiv - Cell Biology 2020Quote: ... mirVana miR inhibitor negative control #1 (Cat 4464076, Ambion), hsa-miR-494-3p inhibitor (MIMAT002816 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... miR-31 inhibitor (Invitrogen™ mirVana™ miRNA Inhibitors) was cotransfected using the same method as for DNA (Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... hsa-miR-10 (Applied Biosystems miRNA assay ID 000387), hsa-miR-129 (Applied Biosystems miRNA assay ID 000590 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells transfected using scrambled sequence anti-miR (Ambion, USA) served as a negative control ...
-
bioRxiv - Molecular Biology 2020Quote: ... miR-200a-3p (MC10991) and negative control miRNA (Ambion) were used for these transfections.
-
bioRxiv - Molecular Biology 2020Quote: ... Synthetic miR-324 duplex and Decade Markers System (Ambion) were loaded as size markers ...
-
bioRxiv - Neuroscience 2022Quote: ... hsa-miR-129 (Applied Biosystems miRNA assay ID 000590) and hsa-miR-132 (Applied Biosystems miRNA assay ID 000457).
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently miR-9-specific TaqMan assay (Applied Biosystems) in the Step One plus Real-time PCR system (Applied Biosystems).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... a Cy3-Dye-labeled miR scramble control (ThermoFisher Scientific) was loaded into the MLNPs using the same method as described above.