Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... with 20 μg/ml of 7-aminoactinomycin D (7AAD, Invitrogen A1310) in perm/wash (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). The primers are listed in Supplemental Table 3 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Pathology 2024Quote: ... on a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or LipofectamineTM 2000 (Thermo Fisher, COS-7 and SH-SY5Y cells). Imaging was performed 24 h after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... A ViiA™ 7 Real-Time PCR System (Applied Biosystems. USA) was used to perform RT-qPCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... in StepOneTM or ViiATM 7 Real-Time PCR Systems (Applied Biosystems). All PCR reactions were done with technical duplicates or triplicates and then normalized to the GAPDH housekeeping gene ...
-
bioRxiv - Cell Biology 2024Quote: ... Potassium chloride (7447-40-7-500G) was obtained from Fisher Scientific. Paraformaldehyde (16% ...
-
bioRxiv - Cell Biology 2024Quote: Real-time search (RTS)7 was executed in XCalibur (ThermoFisher Scientific). RTS was performed on MS2 scans using a concatenated forward and reverse human reference proteome based on the FASTA file available from Uniprot (updated December 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... AlexaFluor 568 goat anti mouse (Invitrogen, A11004, 7 RRID:AB_2534072, 1:2000), AlexaFluor 568 anti rabbit (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and resuspended in 0.1 ml of PBS supplemented with the lipophilic styryl membrane dye N-(3-triethylammoniumprpyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64, Molecular Probes, Invitrogen; 10 μg.ml-1) (Pogliano et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: 293T cells grown in 96-well plates (3-4×104 cells / well) were co-transfected by Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA USA) with reporter plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were transfected at DIV 3-4 with mRFP-Rab7 (0.8 μg DNA per well) using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) followed by fixation (4% PFA ...
-
bioRxiv - Cell Biology 2022Quote: ... The lysate was centrifuged at 1000 g for 3 min at 4 °C to remove debris and then the supernatant was incubated with anti-HA magnetic beads (Thermo Fisher Scientific, cat. # 88837) for 6 minutes at 20 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... blotted from both sides for 3 seconds at 4 ℃ under 99% humidity and plunge frozen in liquid ethane using Vitrobot Mark IV (Thermo Fisher Scientific, Waltham, MA). Images were recorded using a Titan Krios G4 microscope at the University of Tokyo (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: EAT (occluded and non-occluded tissue pooled) from exercise-trained (n=4) and sedentary (n=3) female pigs had total RNA extracted with TRIzol® (Thermofisher Scientific, Waltham, MA). Total RNA was quantified (Nanodrop 3300 ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were then incubated for 3 h at 4 °C with 50 mL of Pierce Protein-G beads bound with mouse anti-Ty antibody (Invitrogen Ty1 Tag Monoclonal BB2). Beads were washed 6 times with wash buffer (200 mM Tris pH 9 ...
-
bioRxiv - Immunology 2023Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 4 μM Mag-Fluo-4 (ThermoFisher Scientific) and 1 μM F-127 (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...