Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... We used siDESIGN Center (Horizon Discovery) to design siRNA (siUNG#4) targeting the 3′UTR region of UNG mRNA (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... and probed overnight at 4°C with the following primary antibodies diluted in 1x TBS-T with 3% BSA (Fisher Scientific BP1600): α-SARM1 (BioLegend 696602 ...
-
bioRxiv - Biochemistry 2024Quote: HEK-293 cells (ATCC, CRL-1573) were subcultured every 3-4 days in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, 41965-039) supplemented with 10% v/v fetal bovine serum (Sigma Aldrich ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... with 4% sucrose/4% formaldehyde (ThermoFisher Scientific) in 1X PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Genetics 2023Quote: ... 4 mM 4-acetamido-4’- maleimidylstilbene-2,2’-disulfonate (AMS) (Invitrogen, catalogue no. A485), and then keep in the dark at room temperature for 1.5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... We incubated overnight with the anti-GFP primary antibody at 4 degrees (1:1000, A-6455 Invitrogen, 0.1M PBS 0.3% tx100, 3% NGS). After abundant PBS washes ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Genomics 2022Quote: ... Plasmids were mixed in a 3:1 weight ratio of total plasmid DNA:PEI in 4 mL of either OptiMeM™ (Gibco cat. # 31985-062) or serum-free DMEM per flask and then shaken vigorously for 30 sec ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We extracted total RNA from 3-4 biological replicates per sex and line with a PureLink RNA purification kit (Thermo Fisher Scientific, USA) and validated the samples with the Bioanalyzer RNA 6000 Nano kit (Agilent) ...
-
bioRxiv - Neuroscience 2022Quote: Mammary glands were harvested from lactating GCaMP6f;K5CreERT2 mice diced into 3- to 4-mm3 pieces and loaded with CellTracker Red (1.5 μM, ThermoFisher C34552, ThermoFisher, Waltham, MA) for at least 30 min in DMEM/F12 containing 10% FCS ...
-
bioRxiv - Microbiology 2023Quote: ... The N concentrations were determined by dry combustion of a 3-4 mg sample with a Flash EA1112 elemental analyzer (Thermo Scientific, Rodano, Italy).
-
bioRxiv - Cell Biology 2023Quote: ... and lentiviral vector expressing GFP-UMOD-WT or GFP-UMOD-H177- R185 del at a ratio of 3:1:4 using Lipofectamine 3000 Reagent (ThermoFisher Scientific, Waltham, MA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and two solid-phase extraction columns (150 µm × 3 cm) packed with MAbPac particles (C8 resin, 4 µm diameter, 300-Å pore size; Thermo Fisher Scientific) were used ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed 3 times with 200 µL PBS for 4 min before secondary antibodies and 1 µg/mL Hoechst (Thermo Fisher Scientific #33342) were added in 35 µL per well and incubated for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Genomics 2019Quote: ... 3 (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Plant Biology 2020Quote: ... Data acquisition and quantification was performed with Chromeleon 7 (Thermo Scientific).
-
bioRxiv - Biophysics 2021Quote: ... cells were harvested at day 7 using trypsin-EDTA (Fisher Scientific) and centrifugation (320g ...
-
bioRxiv - Cell Biology 2020Quote: ... on a QuantStudio 7 Flex real-time PCR detector (Thermo Fisher). Relative mRNA levels were normalized to those of GAPDH mRNA in each reaction and undetermined raw Ct values were set to 40 for analysis purposes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on a Viia 7 Real-Time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... 7 µL of molecular grade water (Fisher Scientific UK Ltd, UK) and 2 μL of DNA template at the original sample concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). All primers were used at 10 μM and sequences can be found in Table 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... on the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Each biological replicate was measured in technical duplicates ...
-
bioRxiv - Plant Biology 2019Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Ct values for the gene of interest are expressed relative to that Ct value found for primers targeted to AT1G13320 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Life Technologies) was added to the cells and they were incubated for one hour ...
-
bioRxiv - Immunology 2020Quote: ... and the ViiA 7 Real-time PCR system (Thermo Fisher Scientific). Primers used in this study are listed in Suppl ...
-
bioRxiv - Biochemistry 2019Quote: ... The coding region for MCM3-7 were cloned into pFastbac (ThermoFisher). MCM3 was cloned with an N-terminal FLAG tag (DYKDDDDK ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 7 µl of 100X Halt protease inhibitor (Thermo Fisher Scientific). After 15 min of thawing and resuspension ...
-
bioRxiv - Physiology 2019Quote: ... QuantStudio 7 Flex Real time PCR system (Applied Biosystems Life Technologies)
-
bioRxiv - Physiology 2019Quote: ... QuantStudio 7 Flex Real time PCR system (Applied Biosystems Life Technologies)