Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... Succinimidyl 6-(4, 4’-azipentanamido)hexanoate (LC-SDA; Thermo Scientific) crosslinking was performed by adding the reagent to final 1mM concentration ...
-
bioRxiv - Neuroscience 2022Quote: ... A glass coverslip (4×4 mm, #1.5 thickness; Thermo Scientific) was positioned over two-thirds of the craniotomy ...
-
bioRxiv - Immunology 2023Quote: ... and 4 ng/ml IL-4 (Fisher Scientific, #404-ML) was added to each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Biochemistry 2020Quote: ... TFA and 1 μL of this dilution and 1μL of the undiluted peptides from bands 3 and 4 were injected onto the trapping column (Thermo Scientific, PepMap100, C18, 300 μm × 5 mm), using a partial loop injection ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and incubated overnight at 4°C with primary antibody solution: Antibody in IF buffer containing 3% Saponin (Fisher Scientific, Cat. No. 55-825-5100GM). Antibodies used were as follows ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Genomics 2019Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... SSEA-4 (ThermoFisher), Sox2 (Epitomics ...
-
bioRxiv - Physiology 2021Quote: ... fluo-4 (Invitrogen). Ca2+ and Lifeact images were acquired at 1 image/10 seconds.
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (ThermoFisher), 1% Sodium Pyruvate (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 4 % FCS (Gibco), 200 units/mL penicillin and 0.2 mg/ mL streptomycin ...
-
bioRxiv - Genomics 2021Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4% B27-(ThermoFisher), 100 µM Palmitate (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a ViiA 7 or 7900 HT Real-Time PCR system (Applied Biosystems). Data analysis was performed using the RQ Manager (Applied Biosystem ...
-
bioRxiv - Molecular Biology 2020Quote: ... MCF-7 passage cell line were prepared using 0.05% trypsin solution (Invitrogen, Carlsbad) and seeded in 96 well tissue culture plates ...