Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for PD 1 Human HEK293 mFc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Images for the case of PD and case 2 of PDD were acquired using a Falcon-4 detector (Thermo Fisher Scientific). Images for case 1 of PDD and case 1 of DLB were acquired using a Falcon-4i detector (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: The processing of whole-cell protein quantitation raw LCMS data for peptide and protein identification and quantification was performed with Proteome Discoverer (PD v3.0 (Thermo Fisher Scientific) using a SPS MS3 reporter ion-based quantification workflow ...
-
bioRxiv - Cell Biology 2023Quote: ... The suspension was centrifuged for 10 min at 4°C and 15,000 g to remove cell debris before the supernatant was applied to a PD-10 desalting column (Thermo Fisher Scientific) to remove excess free biotin using the centrifugation protocol according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: MS and MS/MS raw data were translated to mascot general file (mgf) format using Proteome Discoverer (PD) version 2.4 (Thermo Fisher Scientific) and searched using an in-house Mascot Server v ...
-
bioRxiv - Biochemistry 2022Quote: MS and MS/MS raw data were translated to mascot general file (mgf) format using Proteome Discoverer (PD) version 2.5 (Thermo Fisher Scientific), and searched using an in-house Mascot Server v ...
-
bioRxiv - Neuroscience 2023Quote: ... Mus musculus retrieved in 2018) using the Sequest HT search engine within Thermo Proteome Discoverer (PD) version 2.3 (Thermo Fisher Scientific). The following PD parameters were applied ...
-
bioRxiv - Biochemistry 2024Quote: ... The total protein (Pd-CI and MSP2N2) concentration was determined using the Pierce™ bicinchoninic acid (BCA) assay (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Immunology 2021Quote: ... IgGs and 6xHis-tagged Fabs were expressed by transient transfection of paired heavy chain and light chain expression plasmids into HEK293-6E or Expi293 cells (Life Technologies). Fabs and IgGs were purified from transfected cell supernatants using Ni-NTA (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... a heavy chain (HC) and light chain (LC) plasmid was generated for co-expression in HEK293 suspension culture cells (Expi293F cells) (Fisher Scientific). For species specificity swapping experiments ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... 293 cells from a pMLINK tetracistronic vector (courtesy of Y. Shi, Tsinghua University, Beijing).45 HEK293 cells were cultured in Freestyle 293 media (Life Technologies), shaking at 125 rpm while incubating at 37 oC with 8% CO2 until a density 2 × 106 cells/ml was reached ...
-
bioRxiv - Immunology 2021Quote: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific). Two days later ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 S gene containing plasmid p20017 and adenovirus backbone plasmid pAADV-C01 (Genemedi, China) were co-transfected into HEK293 based adapted viral production cell (ThermoFisher, USA). Viral production cells were seeded in a 6 well TC treated plate (Nest ...
-
bioRxiv - Cancer Biology 2022Quote: ... LCV2-GFP or LCV2-RFP were mixed with sPAX2 and MD2.G plasmids and transfected in HEK293 cells using Lipofectamine 2000 (Life Technologies). After 24h ...
-
bioRxiv - Neuroscience 2022Quote: SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (SP-RBD, Arg319-Phe 541; cat# RP-87678, HEK293 cell expressed and binds ACE2) was obtained from Life Technologies Corporation ...
-
bioRxiv - Biochemistry 2024Quote: ... A549 and the HEK293 cell line stably transduced with a firefly luciferase reporter under the control of a synthetic NF-κB promoter (HEK293-NF-κB_luc, BPS-Bioscience) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Cat# 61965-026) supplemented with 10 % fetal calf serum at 37 °C in a 5 % CO2 incubator.
-
bioRxiv - Immunology 2024Quote: ... We electroporated 3 μg of ODNs or gDNA into 2 × 106 HEK293 and 293A cells by Neon Transfection System (Thermo Fisher) based on the manufacturer’s introductions.
-
bioRxiv - Developmental Biology 2024Quote: Cultured HEK293 cells were grown on 12 mm round cover glasses (Azer Scientific, #200121) pre-coated with poly-D-lysine (Gibco, #A3890401) in 24-well plates and then transfected with a plasmid encoding HA-tagged neurexin1 alpha using lipofectamine 2000 ...
-
bioRxiv - Physiology 2023Quote: Cell surface proteins from transfected HEK293 cells were biotinylated using the Pierce Cell Surface Protein Isolation Kit (ThermoFisher Scientific., cat# 89881). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... All soluble SOSIP Envs were expressed by transient transfection in HEK293-6E cells (National Research Council of Canada) or Expi293 cells (Life Technologies) and purified from transfected cell supernatants by 2G12 affinity chromatography ...
-
bioRxiv - Genetics 2023Quote: HEK293 cells were harvested and lysed in RIPA lysis with 1X Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). The concentration of total protein was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Constructs carrying the 3’UTRs were transiently co-transfected with vectors carrying Renilla-Luciferase and either miR-122 mimic (122-MIM) or scramble oligos (SCR) into HEK293 cells with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 4 × 106 HEK293 Flp-In T-Rex cells with EGFP integrants were seeded in 15-cm dishes (Thermo Fisher Scientific) and incubated overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... including Camuiα were transfected into HEK293S GnTI-cells (2 x 106 cells per well in 6-well plates) cultured in FreeStyle 293 (Thermo Fisher), using the TransIT2020 transfection reagent (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Culture inserts were removed 8h prior to imaging and HEK293 culture medium was changed to imaging medium – phenol red-free DMEM (Gibco, #31053028) with 10% FCS (Biosera ...
-
bioRxiv - Cell Biology 2023Quote: ... Flp-In HEK293 cells were co-transfected with the pCDNA3-TurboID-cyclin F plasmid and the pOG44 Flp-Recombinase Expression Vector (Invitrogen, V600520) for co-expression of the Flp-recombinase using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...