Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 2-4 seconds at a blotting force of 4 and plunge-frozen in liquid ethane using a MarkIV Vitrobot (Thermo Fisher Scientific). The chamber was maintained at 8 °C and 100% humidity during freezing ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatant was kept after spinning at 800 rcf for 2’ at +4°C and were incubated overnight at +4°C with 3µg of dedicated antibodies: Nr2f1 antibody (Thermo Fisher PA5-21611) and GFP antibody (Abcam ab13970 ...
-
bioRxiv - Immunology 2020Quote: ... 2-4 × 105 cell equivalents per well were loaded into a NuPAGE 4-12% Bis-Tris density gradient gel (Thermo Fisher Scientific) and ran at a constant 150V for 80 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded with the calcium indicator Fluo-4 by incubating in supplemented NB medium that contained 2 µM of Fluo-4 AM (Invitrogen, Carlsbad, CA), and Pluronic F-127 (0.04% ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated for 2–3 min at RT in trypsin (0.05% v/v; Gibco 25300-054), and tapped to release ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 12 mM 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium (MTT) (Thermo Fisher Scientific, #M6494). After 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... and SARS-CoV-2 [3]) was performed with Proteome Discoverer version 2.4 (Thermo Fisher Scientific). The search was restricted to human and SARS-COV-2 proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg of RNA was digested with Turbo DNase (2 U/μl, # AM1907, ThermoFisher Scientific). 500 ng of DNase-digested RNA was tagged with G/I tails in a 10 μl reaction ...
-
bioRxiv - Immunology 2022Quote: ... Cells were activated for 3 days in presence of 100 U/mL IL-2 (Gibco) and 1 µg/mL PHA (Remel).
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Microbiology 2021Quote: ... and 2-3 cm) after measuring the DNA concentration with Qubit (QubitⓇ 2.0 Fluorometer, Invitrogen). We obtained eight metagenomes from Lake Sarnen (deepest and shallow_inflow station for March ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... where an Acclaim PepMap 100 (2 cm x 75 μm, 3 μm particles; Thermo Fisher) pre-column was connected in front of an EASY-Spray PepMap RSLC C18 reversed phase column (50 cm x 75 μm ...
-
bioRxiv - Molecular Biology 2019Quote: ... an Acclaim PepMap 100 (2 cm x 75 μm, 3 μm particles, Thermo Fisher Scientific) pre-column was connected in front of an EASY-Spray PepMap RSLC C18 reversed phase column (50 cm x 75 μm ...
-
bioRxiv - Microbiology 2021Quote: ... an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)) assay (M6494, Thermo Fisher Scientific) was conducted in parallel to the infection and kinase inhibitor treatment according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were prepared by incubating with a 2% solution of 3-aminopropyltrimethyoxysilane (313255000, Acros Organics) diluted in isopropanol ...
-
bioRxiv - Biochemistry 2021Quote: ... a pEntryslot3 vector containing the let-858 or tbb-2 3’UTR and pDEST (ThermoFisher) in an LR reaction ...
-
bioRxiv - Biophysics 2019Quote: ... Medium was changed every 2-3 days and cells were harvested with TrypLETM Express (Invitrogen) at 80%-90% confluency ...
-
bioRxiv - Cell Biology 2021Quote: siRNA transfections were performed 2 or 3 days before each experiment using Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... All cell lines were passaged every 2-3 days using 0.05% Trypsin/EDTA solution (Gibco).
-
bioRxiv - Cell Biology 2022Quote: ... Coverslips were prepared by incubating with a 2% solution of 3-aminopropyltrimethyoxysilane (313255000, Acros Organics) diluted in isopropanol ...
-
bioRxiv - Genomics 2022Quote: ... The remaining RNA (< 3 µg) was treated with 2 U TURBO™ DNase (Invitrogen, USA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were DNase treated (3 µL of Turbo RNase-free DNase, 2 U/µL, ThermoFisher) for 20 min at 37°C and then precipitated by addition of 290 µL of water ...
-
bioRxiv - Genomics 2024Quote: ... Cells were passaged every 2-3 days by detachment with 0.05% trypsin-EDTA (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... passage 2-3 NPCs were detached with Stempro Accutase cell dissociation reagent (A1110501, Life Technologies) and kept in cold PBS 1%FBS for the duration of the protocol ...
-
bioRxiv - Immunology 2024Quote: ... 10% heat inactivated fetal bovine serum (HIFBS) 2 × 10-3 m L-glutamine (Life Technologies), antibiotic antimycotic (1× ...
-
bioRxiv - Biochemistry 2024Quote: ... Cytotoxicity was determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher: M6494) reduction analysis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Organoid images were digitally acquired every 2–3 days on an EVOS M7000 (ThermoFisher, AMF7000) with DiamondScope software (version 2.0.2094.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were aspirated and 2-3 crystals of Dil stain (Life Technologies-Molecular Probes) were added to each culture well and incubated on a shaker for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were aspirated and 2-3 crystals of Dil stain (Life Technologies-Molecular Probes) were added to each culture well and incubated on a shaker for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Supernatant was carefully removed and resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 20 min at 37 °C ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were subcultured every 2-3 days and transfected with lipofectamine 2000 transfection reagent (Invitrogen) in Opti-MEM medium (Thermo Fisher ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400, Thermo Fisher, USA) with stem-loop primers and sly actin_R primers as internal controls (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were passaged every 2–3 days using 0.25% Trypsin-EDTA (1X) (Gibco, Cat# 25200056) as the dissociation buffer ...
-
bioRxiv - Genomics 2023Quote: ... mESCs were routinely passaged at ∼80% confluency every 2-3 days using TrypLE Express (ThermoFisher). Before experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... Passaging was performed every 2 to 3 days using Accutase (00-4555-56, ThermoFisher Scientific). The cells were Mycoplasma tested prior to running experiments ...
-
bioRxiv - Immunology 2024Quote: ... 10% heat inactivated fetal bovine serum (HIFBS) 2 × 10−3 m L-glutamine (Life Technologies), antibiotic antimycotic (1× ...
-
bioRxiv - Neuroscience 2021Quote: ... F4/80 (clone BM-8, eFluor450, 4 µg/ml, Invitrogen), CD11c (clone N418 ...
-
bioRxiv - Neuroscience 2021Quote: ... into jaw closer muscles of 5-8 day old mouse pups with 1-2% dilution of Alexa Fluor 488 hydrazide (Life Technologies), under isoflurane anesthesia.
-
bioRxiv - Immunology 2020Quote: T or B cells (2-4 × 107) obtained from 2 spleens of actin-GFP mice by negative MACS kits (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was changed to DMEM/F-12 supplemented with 1× N-2 supplement (Life Technologies), 2 µg/mL heparin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Secondary antibody anti-rabbit Alexa Fluor 488 F(ab’)2 (A11070, Invitrogen, dilution 1:500) in PBS-Tx supplemented with 1% BSA was incubated overnight at room temperature ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...