Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... then incubated with anti mouse F(ab’)2 -Alexa647 (Invitrogen) secondary antibodies at 1:500 in PBS-1%BSA for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2 µL f 15 mg/mL Glycoblue (Invitrogen, AM9515). RNA was precipitated over night at -20 °C followed by centrifugation at 13,000 x g for 15 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3%-8% NuPAGE Tris-Acetate Protein Gels (Thermo Fisher Scientific) for high molecular weight proteins ...
-
bioRxiv - Pathology 2019Quote: ... Samples were analysed on NuPAGE Tris-acetate 3-8% gel (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Gradient gels (3% - 8% Tris-acetate protein gels, Thermo Fisher Scientific) were loaded with the lysates and run for 55 min at 150 V in Tris-tricine buffer (50 mM Tris ...
-
bioRxiv - Biochemistry 2021Quote: ... In a NuPAGE 3-8 % Tris-Acetate gel (NOVEX Life Technologies), 15 μg protein was loaded with 5 x loading buffer (0.05 % Bromophenol Blue ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were resolved by Tris-acetate NOVEX NuPAGE 3-8% (Invitrogen) (SorLAFL and SorLA2131 ...
-
bioRxiv - Molecular Biology 2022Quote: ... IP samples were analyzed on 3–8% tris-glycine gels (Invitrogen). Additionally ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were run on NuPAGE 3-8% Tris Acetate Gel (Invitrogen) in Tris-Acetate SDS Running Buffer (Novex) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein lysates were resolved on 3-8% (Thermo Fisher Scientific EA0375BOX) or 4-12% gradient SDS-PAGE gels (Thermo Fisher Scientific NP0321BOX) ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 3-8% Tris-Acetate gels (Invitrogen #EA0375) using Tris-Acetate SDS running buffer (Invitrogen #LA0041) ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Systems Biology 2019Quote: The 72 fractions obtained from the OG fractionation (3 TMT x 24 fractions) were loaded on a trap nanocolumn (0.01 x 2 cm, 5 μm; Thermo Fisher Scientific, Massachusetts, USA) and separated with a C-18 reversed-phase (RP ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Physiology 2019Quote: ... Fluo-4 AM and Pluronic F-127 (Molecular Probes, Eugen, OR, USA), anti-Actin and anti-GAPDH antibodies (Proteintech Group ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... Braun) were cultured in 3 parts DMEM and 1 part Ham’s F-12 Nutrient Mix (Thermofisher scientific 11765054), supplemented with 10% fetal bovine serum (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... blocked and stained for F-actin (phalloidin-Alexa Fluor 647; Invitrogen; 1:100 in 3% BSA in PBS) for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.