Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for 7 CHLORO 2 ETHYL 1H INDENE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated 1h at RT in the dark with a secondary antibody solution containing goat anti-mouse Alexa 594 (A11032, Invitrogen, Fisher Scientific) fluorescent-coupled antibody diluted to 1:1000 in PBS-T solution ...
-
bioRxiv - Microbiology 2024Quote: ... then the following secondary antibodies were diluted 1:500 in blocking buffer and incubated for 1h with the cells: anti-rabbit DyLight 448 (Thermo Scientific, 35552), anti-rabbit DyLight 550 (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% Donkey Serum, 1% Triton-100, 1h) followed by primary (overnight, 4°C) and secondary antibodies (1-2h, Jackson ImmunoResearch or ThermoFisher Scientific) incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies in 10% GS in 1xPBS overnight at 4°C followed by a 1h incubation with anti-mouse (A11003, Invitrogen, 1:800) secondary antibody in 10% GS in 1xPBS at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody incubation with anti-rabbit-HRP and anti-mouse-HRP was done at room temperature for 1h in 5% milk in TBS-T and the signal developed using an ECL mixture (Life Technologies, 32132). For a detailed list of antibodies see Supplementary Table 2 ...
-
bioRxiv - Genetics 2023Quote: ... 1 μL was spotted onto a C+Y-10% polyacrylamide pad (incubated twice for 1h in C+Y medium supplemented with daptomycin when applicable) inside a Gene Frame (Thermo Fisher Scientific) sealed with a cover glass ...
-
bioRxiv - Biochemistry 2023Quote: ... the slides were incubated with primary antibodies in PBS containing 5% BSA for 2 h and then with the following secondary antibodies for 1h at room temperature: Donkey Anti-Rabbit Alexa 488 (1:1000; Invitrogen; A21206, 2376850) and Donkey Anti-Chicken Alexa 594 (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: 250’000 Jurkat cells or purified T cells were seeded onto a 24-well plate and transduced at an MOI of 5 via spin-infection for 1h at 800xg and 32°C in 450 µl RPMI-1640 medium (Gibco, #42401-018) containing 50 µl of 100-fold concentrated lentiviruses ...
-
bioRxiv - Microbiology 2023Quote: ... The cell membrane fraction was isolated from the lysates by performing ultracentrifugation at 66000g for 1h (Sorvall WX Ultra 80 Centrifuge, Thermo Fisher Scientific). After resuspending the obtained pellet with PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... stained with primary antibody for 1h at 37° C and labeled against F-actin (1:60 in PBS Alexa Fluor® 488 Phalloidin-Invitrogen, # A12379) and DNA (NucBlue ...
-
bioRxiv - Cell Biology 2024Quote: ... incubated in blocking buffer supplemented with 1 µg/ml Hoechst 33342 for 1h at RT with secondary antibodies: Alexa Fluor 647 goat anti-mouse (Invitrogen, A-21236), Alexa Fluor 488 chicken anti-rabbit (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: The relative mitochondrial transmembrane potential (ΔΨm) was measured using the membrane-potential-dependent fluorescent dye TMRE (Tetramethylrhodamine, Ethyl Ester, Perchlorate) (Molecular Probes, Thermo Fisher Scientific)[87] ...
-
bioRxiv - Cancer Biology 2022Quote: ... with or without N-ethyl-N-nitrourea 10μg/ml or 50μg/ml and treated 2h with 1mg/ml Collagenase type IV (Gibco by life technologies ref 17104-019).
-
bioRxiv - Molecular Biology 2023Quote: ... and brain tissues were weighed and homogenized at a density of 140 mg of dry tissue per milliliter in ethyl acetate / isopropanol (4:1) using a Bead Mill 4 homogenizer (Thermo Fisher Scientific, Waltham MA) and 2-mL pre-filled polypropylene microtubes (2.8 mm ceramic beads ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...
-
bioRxiv - Cell Biology 2020Quote: ... COS-7 cells were grown on thin coverslips (Thermo Fisher Sci. 12541A) in 6 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR reaction was run in ViiA 7 Real-Time PCR System (ThermoFisher) with standard program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95 °C with a rate of 0.015 °C per second ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-caprin-1 (Invitrogen, PA5-96857; at a 7 : 10 000 dilution), anti-G3BP-1 (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... on a Quant-Studio 7 Flex Real-Time PCR System (Applied Biosystems). Transcript abundances were normalized to 18S rRNA abundance ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... with an Applied Biosystems ViiA 7 Real-Time PCR System (Life Technologies). Quantitation of the results was performed by the comparative Ct (2-[delta][delta]Ct ...