Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for 7 CHLORO 2 ETHYL 1H INDENE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...
-
bioRxiv - Cell Biology 2020Quote: ... COS-7 cells were grown on thin coverslips (Thermo Fisher Sci. 12541A) in 6 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR reaction was run in ViiA 7 Real-Time PCR System (ThermoFisher) with standard program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95 °C with a rate of 0.015 °C per second ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-caprin-1 (Invitrogen, PA5-96857; at a 7 : 10 000 dilution), anti-G3BP-1 (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... on a Quant-Studio 7 Flex Real-Time PCR System (Applied Biosystems). Transcript abundances were normalized to 18S rRNA abundance ...
-
bioRxiv - Genomics 2022Quote: ... and HeLa S3 and MCF-7 RNAs were purchased from Thermo Fisher. RNAs from matched frozen healthy/tumor tissues of breast cancer patients were purchased from Origene (500 ng ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... with an Applied Biosystems ViiA 7 Real-Time PCR System (Life Technologies). Quantitation of the results was performed by the comparative Ct (2-[delta][delta]Ct ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using a ViiA7 instrument (ViiATM 7 real-time PCR system, Life Technologies). The sequences of primer for human Naaa are ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the ViiA™ 7 Real-Time PCR System (ThermoFisher Scientific, #4453536). The relative quantification of gene expression was calculated using the 2-ΔΔCt method ...
-
bioRxiv - Bioengineering 2022Quote: ... and a QuantStudio 7 Flex qPCR machine (Applied Biosystems, Bleiswijk, The Netherlands), which was configured with 1 cycle of 10 min at 95 °C and 40 consecutive cycles of 15 s at 95 °C and 1 min at 60 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... on a QuantStudio™ 7 Flex Real Time PCR System (ThermoFisher Scientific). Primer sequences can be found in Table S8 ...
-
bioRxiv - Neuroscience 2021Quote: ... and run on a Quantistudio 7 Flex Real-Time PCR System (ThermoFisher), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... RT-qPCR was performed on the QuantStudio™ 7 Flex (Applied Biosystems) with TaqMan Fast Advanced Master Mix (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Physiology 2022Quote: ... and performed on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). All data were normalized to the expression of the housekeeping genes cyclophilin A (Ppia ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 and 7 days in culture by staining with trypan blue (Invitrogen) or counting with an automated cell counter for viable cells (Fluidlab R-300 cell counter ...
-
bioRxiv - Genomics 2019Quote: ... and incubated in a ViiA 7 Real Time-PCR System (Applied Biosystems) with the program shown in Table S3 and analyzed using QuantStudio Real-Time PCR Software v1.1 (Applied Biosystems) ...
-
bioRxiv - Physiology 2019Quote: ... Reactions were performed using the ViiA 7 RT-qPCR System (Life Technologies), and data analyzed by the ΔΔcT method ...
-
bioRxiv - Physiology 2020Quote: ... then 7×106 cells were incubated with CSFE (Thermofisher, C34554, 1:25000) for 20 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 5-7 minutes before quenching with Knock-Out Media (ThermoFisher Scientific) and centrifuging at 200g for 5 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... IL-7 20ng/ml (Miltenyi) and Lipids (hLDL) 50ng/ml (Life Technologies)63.
-
bioRxiv - Biochemistry 2019Quote: ... 7’-dichlorfluorescein diacetate (DCFH-DA) and MitoSOX fluorescent dyes were from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were transferred to nitrocellulose membranes (iBlot 7-Minute Blotting System, Invitrogen), and membranes were blocked with PBS containing 0.1% Tween 20 (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: ... and performed on ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). All data were normalized to the content of Cyclophilin A (PPIA) ...
-
bioRxiv - Cell Biology 2021Quote: MCF-7 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... The fractions containing PrP were dialyzed (7 kDa MWCO, Thermo Fisher 68700) against 6 L of Dialysis Buffer (10 mM sodium phosphate pH 5.8 ...
-
bioRxiv - Neuroscience 2021Quote: ... 7) anti-GFAP antibody (#14-9892-82, Fisher Scientific, Hampton, NH, USA) for an astrocyte biomarker ...
-
bioRxiv - Neuroscience 2021Quote: ... These were diluted in a solution containing 7 μL Lipofectamine 2000 (Invitrogen) and 250 μL OptiMem ...
-
bioRxiv - Microbiology 2021Quote: The qPCR reactions were performed in the QuantStudioTM 7 Flex (Applied Biosystems). The reaction mix and PCR program used were described before [16] ...
-
bioRxiv - Immunology 2020Quote: ... The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95°C with a rate of 0.015°C per second ...