Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 6974 citations for Recombinant Human OXSR1 GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Cancer Biology 2024Quote: ... human CD3-PE (Invitrogen), and mouse CD45-erpCP Cy5.5 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... the strips were washed 3 times in PBS-T before incubation in primary antibody (GST Tag Mouse anti-Tag, Clone: 8-326, Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... were PCR-amplified and cloned into the pDEST15 vector encoding an N-terminus GST tag using the Gateway Cloning Technology (Invitrogen)27 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rho pull-down assays were performed using GST-rhotekin and Rho-pull down detection kit according to manufacturer’s instructions (Thermo Scientific). The levels of total and active Rho were established by using a Rho-specific antibody ...
-
bioRxiv - Plant Biology 2021Quote: ... to create a fusion to the Maltose-binding protein (MBP) or into pDEST15 for fusions to Glutathion-S-transferase (GST) (ThermoFisher). To create GUS reporter constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... ORFs were cloned in pDEST15 (containing the GST tag) and pDEST17 Gateway (containing the His6 tag) vectors (Thermo Fisher Scientific). For Y2H assays ...
-
bioRxiv - Cell Biology 2022Quote: The TNY1 cDNA coding sequences were cloned into the Gateway pDEST15-GST (glutathione S-transferase) plasmid using the procedures recommended by the manufacturer (Invitrogen) with oligos listed in Supplementary Table 1 ...
-
bioRxiv - Biophysics 2024Quote: ... and then incubated with 50-100 μl 2.3 μM (0.1mg/ml) GST-WCA and various concentrations of Neutravidin (ThermoFisher, Cat. #31000) (8.3 μM (0.5mg/ml ...