Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 20nM has-miR-129-5p miRIDIAN hairpin inhibitor (miR-129 inhibitor) or hairpin inhibitor negative control (inhibitor ctrl) (ThermoFisher Scientific) using LipofectamineTM RNAiMAX (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 10pg of mirVana miRNA mimic miR-199a-5p (ThermoFisher, Assay ID MC10893 and 002304) was added to 0.1-0.5ug of total RNA as a spike-in control for RT-qPCR normalization ...
-
bioRxiv - Microbiology 2019Quote: ... or miR-K6-5p mimic (miRVana) with Lipofectamine RNAiMax (ThermoFisher Scientific, Cat No: 13778150) as instructed ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... miR-504-3p or miR-574-5p were reverse transcribed by using TaqMan™ Advanced miRNA cDNA Synthesis Kit (Thermo Scientific) and then amplified by using specific primers provided in the TaqMan Advanced miRNA Assays (Thermo Scientific ...
-
bioRxiv - Pathology 2020Quote: ... 100 ng of wild-type or mutant reporter vectors were co-transfected with 20 nM miRNA (miR-574-5p or miR-574-3p) into HEK293T cells cultured in 24-well plate using lipofectamine 3000 (ThermoFisher Scientific) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Two sets of primers were used: Megaplex RT Primers Human pool A and B (Thermo Fisher, USA). Together ...
-
bioRxiv - Cancer Biology 2020Quote: ... Capan-1 and Hs 766T were transfected with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218 (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 nM of miR-21-5p inhibitor (Thermo Fisher Cat#4464084 ID#MH10206 Lot#AS02DR3S) or negative control mimic (Thermo Fisher Cat#4464058 Lot#AS02CNS6 ...
-
bioRxiv - Cancer Biology 2019Quote: 50-100ng of genomic DNA from edited cells in a total PCR reaction volume of 50ul were amplified in a 30 cycle PCR using a locus-specific primer set (primer set 1) and AmpliTaq Gold 360 Master Mix (Applied Biosystems) (Supplemental Table 1b) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1-2μl of extracted genomic DNA in a total PCR reaction volume of 25μl were amplified in a 35 cycle PCR using a locus-specific primer set (primer set 1) and AmpliTaq Gold 360 Master Mix (Applied Biosystems) (Supplemental Table 1b) ...
-
bioRxiv - Cancer Biology 2021Quote: ... with miR-92a-specific primers (Applied Biosystems). Quantitative PCR was performed using FAST SYBR green mix (Roche ...
-
bioRxiv - Plant Biology 2022Quote: Custom TaqMan® probes (including RT primers and qRT-PCR primers, Thermo Scientific) were designed using the Small RNA Assay Design Tool with the following input sequences ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each cell line was transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: Capan-1 and Hs 766T were transfected for 72 hours with 100 nM Pre-miR Precursor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion ...
-
bioRxiv - Cancer Biology 2019Quote: ... Knockout in tissue or cells post-cre was confirmed by Q-RT-PCR using primer/probe sets for CIC (Applied Biosystems) and by Western blotting with anti-Cic.
-
bioRxiv - Immunology 2023Quote: ... Real-time RT-PCR was performed using 50 ng of RNA and the Platinum Quantitative RT-PCR ThermoScript One-Step System with FAM primers and probe sets from Applied Biosystems (CCL2 ...
-
bioRxiv - Cancer Biology 2022Quote: in vitro overexpression and knockdown of miR-654-5p were performed by Lipofectamine™ 3000 (Invitrogen)-mediated miRNA Agomir and Antagomir transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 nM of duplex miR-21-5p mimics (Thermo Fisher Cat#4464066 ID#MC10206 Lot# AS02E016), 100 nM of miR-21-5p inhibitor (Thermo Fisher Cat#4464084 ID#MH10206 Lot#AS02DR3S ...
-
bioRxiv - Genetics 2019Quote: ... miR-199b-5p inhibitor or scrambled inhibitor negative control using Lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA). Forty-eight hours after transfection ...
-
bioRxiv - Cell Biology 2021Quote: HPK at 70% confluency were transfected with miRNA mimics at 10nM: miR-30a-5p (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: miR-139-5p expression levels were analyzed using TaqMan MicroRNA Assay (Cat#: 4427975, Thermo Fisher Scientific) and a TaqMan Universal Master Mix II no UNG with a StepOnePlus RT PCR system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The probe sequences for mmu-miR-129-5p and U6 snRNA were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic RNA was then amplified in six equal-sized segments using overlapping primers sets (Supplementary Table S8) using SuperScript III One-Step RT-PCR kit (ThermoFisher Scientific, USA) with Platinum Taq ...
-
bioRxiv - Microbiology 2024Quote: ... extracted RNA was mixed with either Uni or Opti primer sets in a Platinum SuperScript III One Step RT-PCR kits (Invitrogen, Carlsbad, CA) for amplification ...
-
bioRxiv - Cancer Biology 2019Quote: ... precursor and mature miR-15a/miR-16 specific primers were purchased from Thermo Fisher. cDNA synthesis was performed by the High Capacity cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers specific for mmu-miR-147-3p (alias, hsa-miR-147b; Applied Biosystems). The relative abundance of EV miRNA was determined by TaqMan PCR using TaqMan Universal PCR Master Mix II and TaqMan primers and probes from Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... mimics for murine miR-147-3p or miR-298-5p and Lipofectamine® RNAiMAX Reagent were resuspended with Opti-MEM® Medium (Gibco, Waltham, MA, USA) and incubated for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were transfected at DIV7 with 10nM of the miR-499-5p or control mimic (Ambion™ Pre-miR miRNA Precursor ...
-
bioRxiv - Molecular Biology 2023Quote: ... miRNA probes for mature sequence of miR-7a-5p were obtain from available commercial catalog (Thermo scientific) and label probes for A670 were used ...
-
bioRxiv - Bioengineering 2021Quote: ... qRT-PCR reactions were then set up using RT-PCR kit (Applied Biosystems, ThermoFisher Scientific). Primers used are listed in Table S3.
-
bioRxiv - Bioengineering 2021Quote: ... qRT-PCR reactions were then set up using RT-PCR kit (Applied Biosystems, ThermoFisher Scientific). Primers used are listed in Table S3.
-
bioRxiv - Cell Biology 2020Quote: ... PCRs with different primer sets were conducted by using DreamTaq Green PCR Master Mix (Thermo Scientific) or PrimeSTAR DNA Polymerase kit (Takara) ...
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... RT-qPCR amplification was carried out using ready-to-use Taqman probe/primer sets (Applied Biosystems) to detect expression levels for Lyve1 (Mm00475056_m1) ...
-
bioRxiv - Immunology 2021Quote: ... using TaqMan PCR Master Mix and premixed primers/probe sets (Thermo Fisher Scientific) sets specific for Itgav (Mm00434486_m1) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... KDM primer/probe sets used for qRT-PCR were from Thermo Fisher (4392420): Hs00231908_m1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was set up using the SYBR Green PCR Master Mix (ThermoFisher) and conducted using the StepOnePlus RT-PCR machine (ThermoFisher) ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR probe and primer sets (Table S2) were designed using Primer Express version 3.0 (Life Technologies, Carlsbad, CA). qRT-PCR assay was performed using the AgPath-ID One-Step RT-PCR Buffer and Enzyme Mix (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... miR-218-5p and the internal control snRNA U6 was carried out with TaqMan miRNA kits (Thermo Fisher Scientific). All qPCR assays were performed on Rotor-Gene Q thermocycler (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was synthesized by RT-PCR using oligo d(T) primer (Invitrogen) on a T100 thermal cycler (Bio-Rad) ...
-
bioRxiv - Pathology 2022Quote: ... qRT-PCR analyses were conducted utilizing the Centers for Disease Control 2019-nCoV N1 primers and probe (https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html) and AgPath-ID One-Step RT-PCR reagents (Ambion/ThermoFisher, Waltham, Massachusetts). We included a standard curve of serial dilutions of RNA extracted from SARS-CoV-2 virus stock (107 TCID50/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... MERS-CoV and REBOV were diluted to 2×10-3 and confirmed by their respective monoplex one-step RT-PCR with specific primers using the Verso 1-step RT-PCR kit (Thermo Scientific). The reaction was set up in 10 μl final volume with 100 nM each of unlabelled forward and reverse primers ...
-
bioRxiv - Cell Biology 2022Quote: ... for miR-375 was quantified by TaqMan Assays using the TaqMan MicroRNA Reverse Transcription Kit and hsa-miR-375 primer sets (Thermo Fisher Scientific, 000564). MiR-375 levels were normalized to miR-U6 expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers/probe sets from Applied Biosystems were selected from the Thermo Fisher Scientific web site ...
-
bioRxiv - Neuroscience 2019Quote: ... and TaqMan primer probe sets (ThermoFisher). TaqMan assay ID numbers used ...
-
bioRxiv - Microbiology 2020Quote: ... GAPDH primer/probe sets (Thermo Fisher) were used for normalization of cellular RNA levels.
-
bioRxiv - Biochemistry 2021Quote: ... The sets of primers (ThermoFisher Scientific) were as follows ...
-
bioRxiv - Immunology 2020Quote: ... Taqman primer/probe sets (Thermo Fisher) were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers/probe sets from Applied Biosystems were selected from the Thermo Fisher Scientific website (Supplementary Table 3) ...
-
bioRxiv - Immunology 2019Quote: ... and different primer sets using a QuantStudio 5 Real-Time PCR System (Applied Biosystems) thermocycler ...