Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... miR-16 mimic (miR-16; 50 nM; mirVana® miRNA mimic; MC10339; ThermoFisher Scientific), or the respective negative controls [Lincode Non-targeting Pool (CTR lncRNA ...
-
bioRxiv - Genetics 2020Quote: ... Quantitative real-time RT-PCR (RT-qPCR) assays were performed using SYBR Green Realtime PCR Master Mix (Thermo Fisher Scientific) on an Eppendorf Real-time PCR System MasterCycler RealPlex instrument ...
-
bioRxiv - Microbiology 2020Quote: ... in 20 μl reactions using AgPath-ID One-Step RT-PCR Reagents 10 μl RT-PCR buffer (2X) (Thermo Fisher), 5μl of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-PCR was performed using the Super-Script III One-Step RT-PCR System with Platinum Taq (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The co-transcription was analyzed by RT-PCR using SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen), following the manufacturer’s instructions.
-
Genomic and phylogenetic analyses of SARS-CoV-2 strains isolated in the city of Gwangju, South KoreabioRxiv - Microbiology 2020Quote: ... 1 μL of 25X RT-PCR enzyme mixture included in AgPath-ID One-step RT-PCR Reagents (Thermo Fisher Scientific), 5 μL of RNA ...
-
bioRxiv - Microbiology 2021Quote: RT-PCRs were performed using a SuperScript III One-Step RT-PCR with Platinum Taq DNA Polymerase system (Thermo Fisher). Cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: RT-PCRs were performed using the SuperScript III One-Step RT-PCR with Platinum Taq DNA Polymerase system (Thermo Fisher). Cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-PCR was performed using either the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) or Taqman Fast Virus 1-step master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Gene expression was quantified by quantitative RT-PCR using a StepOnePlus RT-PCR machine (Applied Biosystems, Foster City, CA, USA), TaqMan Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... double-stranded cDNA was synthesized by real-time reverse-transcription (RT-PCR) using Superscript III platinium One-step Quantitative RT-PCR System (Invitrogen) as described previously with minor modifications (Corman et al. ...
-
bioRxiv - Microbiology 2022Quote: ... This DNA-free RNA was then subjected to RT-PCR using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase kit (Invitrogen) with primers specific to the gene of interest (Supplementary Table 2).
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed in a 96-well plate using an Applied Biosystems QuantStudio 6 RT-PCR system (ThermoFisher Scientific). Reactions of 50 μLs in total volume were used which contained ...
-
bioRxiv - Molecular Biology 2023Quote: ... the TFAM mRNA was amplified by RT-PCR using the SuperScript IV One-Step RT-PCR System (Thermo Fisher Scientific). The RT-PCR reaction was further amplified by PCR using inner primers (Extended Table 1).
-
bioRxiv - Microbiology 2023Quote: ... A total of 8.5 µL extracted RNA was subjected to one-step RT-PCR using the Superscript III one-step RT-PCR system (Invitrogen). The one-step RT-PCR was performed using the forward primer Pol F1 5’-TACAGTGCAGGGGAAAGAATA-3’ (nt 4809-4829 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was conducted using the Verso 1-Step RT-PCR Hot-Start kit (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for RT-PCR were RGCP-NdeI-F (5’ ATGGCAAGGAAGAAGGGCAAATCGGCCA 3’ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DNA removal from RNA fractions was confirmed by RT-PCR using the SuperScript IV One-Step RT-PCR System (Invitrogen) with and without addition of SuperScript IV RT Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... or used directly as a template for RT-PCR using SuperScript IV One-Step RT-PCR System (Cat# 12594100, Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... A total of 8.5 µL extracted RNA was subjected to one-step RT-PCR using the Superscript III one-step RT-PCR system (Invitrogen). To amplify the pol region ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 detection was performed using real-time RT-PCR with a probe sets targeting Orf1b and S with FAM fluor (Life Technologies 4332079 assays # APGZJKF and #APXGVC4) multiplexed with an RNaseP probe set with VIC or HEX fluor (Life Technologies A30064 or IDT custom ...
-
bioRxiv - Cell Biology 2022Quote: ... and mirVana® hsa-let7b-5p miRNA mimic (MC24132, ThermoFisher) (50 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... and glass coverslip (12-548-5P/5M/B, Fisher Scientific). The edges of the coverslip were sealed with nail polish.
-
bioRxiv - Microbiology 2022Quote: ... Real time RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudioTM 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene (35) ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription (RT) was performed with the ThermoScript™ RT-PCR System (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... miR-30a-3p (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... the miR designer by Thermofisher was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was performed on ProFlex™ PCR (Thermo Fisher Scientific, USA) using DNA polymerase (QingkeBiotech ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT–PCR was performed using SuperScriptIII One-Step RT–PCR Kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR analyses were performed using SYBR Green RT-PCR kits (Invitrogen) on a Bio-Rad CFX Connect Real-Time system or Roche LightCycler ...
-
bioRxiv - Neuroscience 2023Quote: ... qRT-PCR was performed using an SYBR green RT-PCR kit (Affymetrix), using the Bio-Rad CFX96 Touch™ Real-Time PCR Detection System under the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and quantitative RT-PCR were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genetics 2021Quote: ... and RT-PCR Grade Water (Thermo Fisher Scientific) were used as positive and negative controls for each batch of genotyping ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a StepOnePlus RT-PCR System (Thermo Fisher).
-
bioRxiv - Immunology 2019Quote: ... on a StepOne RT-PCR System (Applied Biosystems). Expression levels were normalized to Gapdh or 18S using the ΔCt method or ΔΔCt relative to control groups.
-
bioRxiv - Developmental Biology 2019Quote: ... RT-PCR products were cloned (TOPO-TA; Invitrogen), and the plasmids purified from individual colonies was/were Sanger-sequenced according to standard protocols to identify the precise alteration of the endogenous gclc transcript.
-
bioRxiv - Genetics 2020Quote: ... and RT-PCR Grade Water (Thermo Fisher Scientific) were used as the positive and negative controls ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A one-step hemi-nested RT-PCR (Invitrogen) was used to detect coronavirus RNA using a set of primers targeting a 440-nt fragment of the RdRp gene and optimized for bat-CoV detection (CoV-FWD3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a StepOnePlus RT-PCR system (Applied Biosystems). Reactions were run in triplicate and mouse Actb was used as a housekeeping gene ...
-
bioRxiv - Physiology 2020Quote: ... in a RT-PCR System (StepOnePlus, Applied Biosystems). PCR reactions were done in duplicate with the addition of negative controls (i.e. ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript IV One-step RT-PCR kit (ThermoFisher) was used for detection of transcripts ...
-
bioRxiv - Physiology 2019Quote: ... Taqman RT-PCR reagents (Applied Biosystems, Carlsbad, CA) were used to generate all cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 2.375 µl RT-PCR grade water (Invitrogen). PCR products were cleaned up with 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2020Quote: ... on a StepOnePlus RT PCR system (Applied Biosystems) or a LightCycler 96 (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... The SuperScript IV RT-PCR system (ThermoFisher Scientific) was used for generating cDNA according to manufacturer’s procedures and final PCR reactions were performed according to standard protocols.
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed with StepOnePlus (Applied Biosystems) using SYBR Green PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: SuperScript IV One-Step RT-PCR System (Invitrogen) was used for RSV whole genome amplification with two separate multiplex RT-PCR reactions using six pairs of primers designed for this study ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR TaqMan gene expression assays (Applied Biosystems) were used to measure the expression of β-actin (ACTB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a StepOnePlus RT PCR system (Applied Biosystems). Relative gene expression levels were normalized to GAPDH ...
-
bioRxiv - Immunology 2024Quote: ... on a QuantStudio 5 RT-PCR (Applied Biosystems). Relative gene expression values were calculated using the delta-delta Ct method ...
-
bioRxiv - Biochemistry 2024Quote: ... Using a QuantStudio 3 RT-PCR thermocycler (Invitrogen), the DSF samples were incubated at 5°C for 1 min ...