Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 2' 3' Dimethyl 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) (Thermo Fisher Scientific, A10044) was added to culture media at 10 µM final concentration for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of 5 × Maxima RTA buffer (Thermo Scientific), which were mixed with Ultrapure water (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Neuroscience 2024Quote: EdU (5-ethynyl-2’-deoxyuridine; #A10044, Thermo Fisher Scientific) was diluted at 10mg/ml in 0.9% NaCl (#114-055-101 ...
-
bioRxiv - Neuroscience 2024Quote: EdU (5-ethynyl-2’-deoxyuridine; #A10044, Thermo Fisher Scientific) was diluted at 10mg/ml in 0.9% NaCl (#114-055-101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridne) (Thermo Fisher Scientific, #A10044) for 4 hours after incubating cells with serum-deprived media (RPMI +10% FBS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or SM/5 plates (2 g glucose (Fisher Scientific), 2 g BactoPeptone (Oxoid) ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol)ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N ′ -dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol) ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... the formazan crystals were dissolved in 100 µl of a 1:2 mixture of dimethyl sulfoxide (DMSO, Invitrogen, Cat#D12345) and ethanol ...
-
bioRxiv - Biochemistry 2021Quote: ... with a 10-fold excess of N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) ethylenediamine (IANBD-amide, Molecular Probes). After 90 min on ice ...
-
bioRxiv - Bioengineering 2024Quote: ... The 1mM stock solution of Rhod-2 is prepared by mixing 44.5 µL dimethyl sulfoxide (DMSO, Thermo Fisher Scientific Inc) with 50 µg Rhod-2 AM (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... that was pre-conjugated to Protein A/G beads (Pierce, 88802) for 2 h 4 °C (note: pre-conjugation crosslinked using 20 mM dimethyl pimelimidate (DMP, ThermoFisher) in borate buffer (40 mM boric acid ...
-
bioRxiv - Biochemistry 2024Quote: ... that was pre-conjugated to Protein A/G beads (Pierce, 88802) for 2 h 4 °C (note: pre-conjugation crosslinked using 20 mM dimethyl pimelimidate (DMP, ThermoFisher) in borate buffer (40 mM boric acid ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and TagRFP-T-VAPB(1-218)-eMagB or TagRFP-T-eMagB-PHOSBP (prey) and iRFP-P4C at a 3:2:1 ratio in OptiMEM-I (Thermo Fisher Scientific) (1:4 DNA ...
-
bioRxiv - Cell Biology 2020Quote: Total cellular mRNA was isolated from cells grown in 2-D and 3-D culture conditions using the GeneJET RNA purification kit (Thermo Fisher Scientific). For analysis of germ layer markers ...
-
bioRxiv - Cell Biology 2020Quote: An aliquot of each sample equivalent to 3 μg was loaded onto a trap column (Acclaim PepMap 100 pre-column, 75 μm × 2 cm, C18, 3 μm, 100 Å, Thermo Scientific) connected to an analytical column (Acclaim PepMap RSLC column C18 2 μm ...
-
bioRxiv - Biochemistry 2022Quote: ... The trap column used for the nano HPLC was a 2 cm × 75 μm capillary column packed with 3 μm C18-silica particles (Thermo Fisher Scientific) and the separation column was a 12.5 cm × 75 μm capillary column packed with 3 μm C18-silica particles (Nikkyo Technos Co. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptide mixtures were loaded on a C18 Acclaim PepMap100 trap-column (75 μm ID x 2 cm, 3 μm, 100Å, Thermo Fisher Scientific) for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed 3 times in PBST and mounted in 4′,6-diamidino-2-phenylindole (DAPI)-containing ProLong Anti-fade Diamond mountant (Thermo Fisher Scientific).