Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... as previously described (11-0311-82; 11-0451-82; 25-5981-82; MA5-23555, respectively; Thermo Fisher) (101) ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue was rinsed in PBS (2 × 5 min) and placed in a 9 mm wide × 0.5 mm deep gasket (Invitrogen) on a glass slide that was previously coated with Poly-L-Lysine (1 µl ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... The alkaline hydrolysis ladder was prepared by incubating 0.4 pmol 5’ end-32P-labeled RNA in 9 µL of 1x alkaline hydrolysis buffer (Ambion) for 5 min at 95°C ...
-
bioRxiv - Physiology 2022Quote: ... Dionex Ionpac AG11-HC b (2 mm x 50 mm, 4 μm particle size, ThermoFisher Scientific), was placed before the separation column ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1% B with Solvent A as 0.1% formic acid in water (Thermofisher Optima LS118-4) and Solvent B as 0.1% formic acid in acetonitrile (Thermofisher Optima LS120-4) ...
-
bioRxiv - Plant Biology 2024Quote: ... and a 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Both HEK293T and A549 cell lines were maintained at 37°C and 5% CO2 in high-glucose DMEM (11-965-092, Gibco), supplemented with 10% fetal bovine serum (Genclone ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 three months old transgenic TgN3R182C150 mice were immunized initially either with 25 µg of aggregated NOTCH3 EGF1-5 protein (n=11, vaccinated) plus adjuvant (Imject Alum Adjuvant, ThermoFisher) or PBS (n=9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and passaged every 3-4 days using Gibco TrypLE Express (ThermoFisher). For imaging ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Genetics 2020Quote: ... in a proportion of 4:3:2 using Lipofectamine 2000 (ThermoFisher). HEK293T cells were maintained in DMEM complete medium (DMEM [Gibco] supplemented with 10% of FBS and 100 UI of Penicillin/Streptomycin) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Developmental Biology 2022Quote: ... Selection of and enrichment for cardiomyocytes was initiated on day 9 by culturing cells for 4 days in RPMI 1640 medium without glucose (Gibco) supplemented with 1x CDM3 supplement (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... The virus pellet was suspended in 0.9% NaCl and sonicated on ice at 20kHz frequency and 70% amplitude for 15 seconds x 3 cycles (FB505, Fisher Scientific). The protein content of the viral lysate was quantified using BCA protein assay kit (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... JE-CVax hyper-immune and non-immune heat inactivated mouse serum samples (starting dilution of 1/9) were serially diluted 3-folds in RPMI 1640 medium (Gibco, ThermoFisher Scientific) supplemented with 4% low IgG serum ...
-
bioRxiv - Genomics 2021Quote: ... 5 × 106 cells were plated in 10 cm dishes and co-transfected with 3 μg VSV-G plasmid and 9 μg of the respective construct Lipofectamine LTX (Thermo Fisher) the following day ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies (3 μg for ChIP-qPCR and 9 μg for ChIP-seq) were coupled to protein G dynabeads (Thermo Fisher Scientific) for 6 hours at 4°C and then incubated with fragmented chromatin over night at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... each well was transfected via master mix 3 µL of siRNAs (20 µM) via 9 µL Lipofectamine 2000 (Invitrogen, #.11668-019) in 300 µL OPTI-MEM (Gibco ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 μL of the nuclei suspension was mixed with 9 μL of 0.4% Trypan Blue Solution (Thermo Fisher, catalog number: 15250061), and the nuclei count was determined under 20X brightfield microscope using a Chemglass Life Sciences Disposable Hemocytometer (Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4′-6-diamidino-2-phenylindol) and Myosin Heavy Chain (Myosin 4, eFluor™ 660, Clone: MF20, Affymetrix eBioscience™). All images were taken using a confocal microscope (Zeiss LSM 780 Airyscan ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 hr at 4°C, then proceeded for immunoprecipitation with specific antibodies (Rab5A, Rab 11 and Rab7) and Protein A/G bead (Thermo Fisher) for overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL was loaded onto an IonPac AS-11 HC strong anion-exchange analytical column (2 mm × 250 mm, 4 µm particle diameter, Thermo Scientific) with AG-11 HC guard column (2 mm × 50 mm ...
-
bioRxiv - Immunology 2020Quote: ... Serial frozen sections (6 μm in thickness) were cut on a cryostat and counterstained with DAPI (4′,6-Diamidine-2′-phenylindole; Thermo Fisher Scientific). The number of beads in the SED from 3-4 sections of two Peyer’s Patches per mouse (n=3–4 mice/group ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were washed (5 min at RT x 3 times) in PBS and incubated (overnight at 4°C) with streptavidin-Alexa 488 (ThermoFisher Scientific, S-11223, 1:500) in PBS-triton 0.05% ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...