Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6 weeks-of-age was fixed in 4% paraformaldehyde (Acros Organics), cryo-preserved using 30% sucrose (Fisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was used to rinse and seal the coverslips ...
-
bioRxiv - Microbiology 2023Quote: ... the fluorescent dsDNA-labelling dye 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) was added to the culture at a concentration of 5 µg.mL−1 for 10 minutes prior imaging ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Molecular Biology 2024Quote: ... slides were counterstained for 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, R37606) for 5-10 mins before mounting ...
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2022Quote: ... and blotted for 4 to 6 seconds at 4°C and 100% humidity using the Vitrobot system (ThermoFisher), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Bioengineering 2022Quote: CD19+ NALM-6 cells (B cell acute lymphoblastic leukemia) were stained with Cell Trace Violet (Thermo Fisher Scientific) and primary human CD8+ T cells were stained with either Cell Trace Yellow (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... 6 rat samples (ExpA, B and C) were placed directly in Leibovitz’s L-15 medium (Gibco 11415-064) to develop organoids immediately ...
-
bioRxiv - Immunology 2024Quote: ... B-7-6 was produced in our own laboratory and was directly conjugated to DyLight (Pierce/Thermo Scientific) fluorochromes ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Plant Biology 2023Quote: ... and 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was set to 45 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 3) injections of fluorophore-conjugated cholera toxin subunit B (CTB 488 or CTB 555; Invitrogen). These manipulations were all targeted to A2 ...
-
bioRxiv - Immunology 2023Quote: ... the chitin preparation was incubated for 3 h with 10 µg/ml polymyxin B (Thermo Fisher), washed by centrifugation ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 5 mL of digestion buffer [composed of 9 mL of phosphate-buffered saline (PBS; Gibco, 10010-023) combined with 1 mL of Dispase (stock ...
-
bioRxiv - Immunology 2023Quote: ... 5% glycerol and then mixed at 9 volumes to 1 volume of 200× concentrate SYPRO orange (Thermo Fisher) diluted in the same buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 1:9 ratio (in 6-well plates at 60-70% confluency) using Lipofectamine®LTX with Plus™ Reagent (Invitrogen) in Opti-MEM according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:6 and 1:9 or 1:10 and 1:100) of ISF samples were prepared using OPTIMEM+ Glutamax-1 (Gibco #51985-026) and kept on ice until lipofection ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dissociated cells were blocked in 6% BSA and immunolabeled with anti-α3 antibody (mouse Anti-ATP1A3 xVIF 9-G10, MA3-915, Invitrogen, Thermo Fisher scientific) for 2 hours 200 times in PBS1x containing 1%BSA or at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... with 9% FBS (ThermoFisher Scientific) and 50 U/ml penicillin ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix. The examined arrays contain the numbers of tag SNPs (array size ...
-
bioRxiv - Molecular Biology 2021Quote: Spodoptera frugiperda 9 (Sf9) (Invitrogen) and High Five™ insect cells (Expression Systems ...
-
bioRxiv - Microbiology 2020Quote: ... 0.4 μM SYTO-9 (Invitrogen) and 6 U Bst3.0 DNA polymerase (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... pH 9 (Gibco 25080-094). Mice were ad lib fed and given an oral gavage of BT2 at 40 mg/kg gavage around 13:00 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sf9 (Spodoptera frugiperda-9; Invitrogen) and High Five (Trichoplusia ni ...