Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... or 3) injections of fluorophore-conjugated cholera toxin subunit B (CTB 488 or CTB 555; Invitrogen). These manipulations were all targeted to A2 ...
-
bioRxiv - Immunology 2023Quote: ... the chitin preparation was incubated for 3 h with 10 µg/ml polymyxin B (Thermo Fisher), washed by centrifugation ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 5 mL of digestion buffer [composed of 9 mL of phosphate-buffered saline (PBS; Gibco, 10010-023) combined with 1 mL of Dispase (stock ...
-
bioRxiv - Immunology 2023Quote: ... 5% glycerol and then mixed at 9 volumes to 1 volume of 200× concentrate SYPRO orange (Thermo Fisher) diluted in the same buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... in a 1:9 ratio (in 6-well plates at 60-70% confluency) using Lipofectamine®LTX with Plus™ Reagent (Invitrogen) in Opti-MEM according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:6 and 1:9 or 1:10 and 1:100) of ISF samples were prepared using OPTIMEM+ Glutamax-1 (Gibco #51985-026) and kept on ice until lipofection ...
-
bioRxiv - Cell Biology 2022Quote: ... with 9% FBS (ThermoFisher Scientific) and 50 U/ml penicillin ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix. The examined arrays contain the numbers of tag SNPs (array size ...
-
bioRxiv - Molecular Biology 2021Quote: Spodoptera frugiperda 9 (Sf9) (Invitrogen) and High Five™ insect cells (Expression Systems ...
-
bioRxiv - Microbiology 2020Quote: ... 0.4 μM SYTO-9 (Invitrogen) and 6 U Bst3.0 DNA polymerase (NEB ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sf9 (Spodoptera frugiperda-9; Invitrogen) and High Five (Trichoplusia ni ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... pH 9 (Gibco 25080-094). Mice were ad lib fed and given an oral gavage of BT2 at 40 mg/kg gavage around 13:00 ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sample was labeled with 5 µl of a TMT 11-plex reagent (20 µg/µL; A37725, Thermo Scientific) for 90 min at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... HPCs in suspension were collected and spun down at 300 xG for 6 minutes and resuspended into microglia basal media (MBM, 2mL/well) containing: DMEM/F12 no phenol (Gibco # 11-039-021), 2% Insulin Transferin Selenite (Gibco # 41400045) ...
-
bioRxiv - Biophysics 2022Quote: ... Oocytes were injected with 0.1 to 10 ng cRNA of mASIC1a (volumes between 9 and 50 nL) and incubated for 1–4 days at 18 °C in Leibovitz’s L-15 medium (Gibco), supplemented with 3 mM L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... NaV1.4 (GenBank: MZ545381.1) expressed in a pCDNA3.1 vector (9) was made using the mMACHINE™ T7 Transcription Kit (Invitrogen). Xenopus oocytes were injected with 3– 6 ng of Pt NaV1.4 and TEVC experiments were performed 1–2 days post-injection ...
-
bioRxiv - Immunology 2021Quote: ... Cells were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... Israel) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Pathology 2020Quote: ... 6-dihydroxy-2,4,5,7-tetraio-dospiro (isobenzofuran-1(3H),9[9H] xanthan)-3:1 dipotassium salt (50 mg/kg in 0.9% saline, Fisher Scientific) was injected retro-orbitally before catalyzing vessel injury with a 540 nm laser ...
-
bioRxiv - Molecular Biology 2020Quote: ... Per2Luc mice and littermate wild-type control mice were euthanized by isoflurane 2-3 hours before lights off (ZT 9–ZT10) and tissues were immediately removed into ice-cold HBSS (Gibco). Coronal brain slices containing SCN (400-µm thickness ...
-
bioRxiv - Immunology 2020Quote: ... TIB-47) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... transfection complexes containing 3 μL of Xtremegene-9 reagent and 500 ng of plasmid DNA were prepared in 100 μL of OptiMEM (Invitrogen). After 20 min of incubation at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... A 11.2 kb PCR product that included a region from CLN3 exon 3 to exon 9 was amplified using a high fidelity polymerase (Platinum Taq High Fidelity, Invitrogen) and CLN3 primers pCLN3F3 and pCLN3R3 (Supplemental Table 2) ...
-
bioRxiv - Microbiology 2024Quote: ... Israel) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Genomics 2019Quote: ... and biotin-11-dUTP (Thermo Scientific). Optimal results were obtained with biotinylated dUTP and dTTP in a 1:5 ratio ...
-
bioRxiv - Immunology 2022Quote: ... CD3-FITC (11-0032-82, Invitrogen), CD4-PE (12-0081-82 ...
-
bioRxiv - Immunology 2022Quote: ... 11 mM HEPES (Gibco, Waltham, MA), and 800 mM L-Glutamine (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... IgD APC (Clone 11-26C, Invitrogen), CD21 APC (Clone 7G6 ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Actinomycin-D (Gibco, 11-805-017) was added to a final concentration of 5 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... CD41 (Thermo Fisher, 11-0411-82) and CD3 (BioLegend ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mouse α-Cadherin-11 (Invitrogen, #5B2H5), Mouse α-E-cadherin (BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: Lipofectamine 2000 (Invitrogen, 11-668-019) was used to introduce interference RNA into A549 cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 11 mM HEPES (Gibco 15630056), plus 50% rat serum (Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD48-FITC (11-0481-85, Affymetrix), CD150-PE-cy7 (115914 ...
-
bioRxiv - Physiology 2022Quote: ... MHCII-FITC (Thermofisher, 11-5321-82), CD64-PE-Cy7 (Biolegend ...
-
bioRxiv - Biophysics 2022Quote: Oven (Fisher Scientific #11-475-152)
-
bioRxiv - Cancer Biology 2023Quote: ... CD49f-FITC (Invitrogen #11-0495-82). All antibodies were bound at room temperature for 10 minutes at a dilution of 1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD49f-FITC (Invitrogen, #11-0495-82), HLA-DR-APCCy7 (BioLegend ...