Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... SYTOTM 9 (ThermoFisher Scientific, S34854). FMTM 1-43 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sample was labeled with 5 µl of a TMT 11-plex reagent (20 µg/µL; A37725, Thermo Scientific) for 90 min at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... Oocytes were injected with 0.1 to 10 ng cRNA of mASIC1a (volumes between 9 and 50 nL) and incubated for 1–4 days at 18 °C in Leibovitz’s L-15 medium (Gibco), supplemented with 3 mM L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... NaV1.4 (GenBank: MZ545381.1) expressed in a pCDNA3.1 vector (9) was made using the mMACHINE™ T7 Transcription Kit (Invitrogen). Xenopus oocytes were injected with 3– 6 ng of Pt NaV1.4 and TEVC experiments were performed 1–2 days post-injection ...
-
bioRxiv - Neuroscience 2022Quote: ... HPCs in suspension were collected and spun down at 300 xG for 6 minutes and resuspended into microglia basal media (MBM, 2mL/well) containing: DMEM/F12 no phenol (Gibco # 11-039-021), 2% Insulin Transferin Selenite (Gibco # 41400045) ...
-
bioRxiv - Immunology 2021Quote: ... Cells were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... Israel) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Pathology 2020Quote: ... 6-dihydroxy-2,4,5,7-tetraio-dospiro (isobenzofuran-1(3H),9[9H] xanthan)-3:1 dipotassium salt (50 mg/kg in 0.9% saline, Fisher Scientific) was injected retro-orbitally before catalyzing vessel injury with a 540 nm laser ...
-
bioRxiv - Molecular Biology 2020Quote: ... Per2Luc mice and littermate wild-type control mice were euthanized by isoflurane 2-3 hours before lights off (ZT 9–ZT10) and tissues were immediately removed into ice-cold HBSS (Gibco). Coronal brain slices containing SCN (400-µm thickness ...
-
bioRxiv - Immunology 2020Quote: ... TIB-47) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... transfection complexes containing 3 μL of Xtremegene-9 reagent and 500 ng of plasmid DNA were prepared in 100 μL of OptiMEM (Invitrogen). After 20 min of incubation at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... A 11.2 kb PCR product that included a region from CLN3 exon 3 to exon 9 was amplified using a high fidelity polymerase (Platinum Taq High Fidelity, Invitrogen) and CLN3 primers pCLN3F3 and pCLN3R3 (Supplemental Table 2) ...
-
bioRxiv - Microbiology 2024Quote: ... Israel) were maintained at 3×105 to 9×105 cells/ml in Roswell Park Memorial Institute medium (RPMI GlutaMAX, Gibco) supplemented with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were stained with 1µM (MOLM-13 and MV-4-11) or 3µM (HL-60) CellTrace Far Red (Thermo Fisher Scientific) to monitor cell divisions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were split every 5-6 days using TrypLE Express (Gibco, #12604013). Each dome required 20-25mins in TrypLE Express with manual pipetting for successful dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µl Klenow-Fragment exo-polymerase (Thermo Fisher, 5 U/µl) were added ...
-
bioRxiv - Biophysics 2021Quote: ... DNA quality was determined by 260nm/230nm and 260nm/280nm ratios on a DS-11+ spectrophotometer (DeNovix) and concentration was determined using the Qubit 3 (Thermo Scientific). Pooled samples were sent to GeneWiz where they were analyzed by TapeStation (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... Aliquots of 15 μg of total protein extract from each sample (3 strains x 4 conditions x 3 replicates) and the three bulks were separated on onedimensional SDS-PAGE short-migration gels (11×1 cm lanes, Invitrogen, NP321BOX). Yeast proteins digestion was performed on excised bands from gel gradient and digested peptides of UPS2 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse transfected with 1 pmol/well of a combination of 3 non-overlapping 11-mer siRNAs (Ambion Silencer® Select, Thermofisher) using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and biotin-11-dUTP (Thermo Scientific). Optimal results were obtained with biotinylated dUTP and dTTP in a 1:5 ratio ...
-
bioRxiv - Immunology 2022Quote: ... CD3-FITC (11-0032-82, Invitrogen), CD4-PE (12-0081-82 ...
-
bioRxiv - Immunology 2022Quote: ... 11 mM HEPES (Gibco, Waltham, MA), and 800 mM L-Glutamine (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... IgD APC (Clone 11-26C, Invitrogen), CD21 APC (Clone 7G6 ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Actinomycin-D (Gibco, 11-805-017) was added to a final concentration of 5 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... CD41 (Thermo Fisher, 11-0411-82) and CD3 (BioLegend ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mouse α-Cadherin-11 (Invitrogen, #5B2H5), Mouse α-E-cadherin (BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2020Quote: Lipofectamine 2000 (Invitrogen, 11-668-019) was used to introduce interference RNA into A549 cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 11 mM HEPES (Gibco 15630056), plus 50% rat serum (Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD48-FITC (11-0481-85, Affymetrix), CD150-PE-cy7 (115914 ...
-
bioRxiv - Physiology 2022Quote: ... MHCII-FITC (Thermofisher, 11-5321-82), CD64-PE-Cy7 (Biolegend ...
-
bioRxiv - Biophysics 2022Quote: Oven (Fisher Scientific #11-475-152)
-
bioRxiv - Neuroscience 2024Quote: ... CD31 (Thermo Fisher, Cat#11–0311), CD140a (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... CD45 (Thermo Fisher, Cat#11–0451), CD31 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... Claudin-11 (rabbit, Invitrogen, 36-4500), CRABP2 (mouse ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD49f-FITC (Invitrogen, #11-0495-82), HLA-DR-APCCy7 (BioLegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD49f-FITC (Invitrogen #11-0495-82). All antibodies were bound at room temperature for 10 minutes at a dilution of 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM Aminoguanidine and 2.5 mM Sodium Ascorbate the reaction allowed to proceed for 6h at room temperature before removal of the biotin excess using Zeba desalting columns (7kDa cut-off, Thermofisher). The samples were then combined altogether at a 1:1:1 ratio within one replicate ...
-
bioRxiv - Genomics 2024Quote: ... Cells were harvested for RNA extraction at 6h and 24h from unstimulated and stimulated PBMCs using TRIzol® (Life technologies) reagent according to manufacturer’s instructions and treated with DNase to ensure elimination of genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...