Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Claudin-11 (rabbit, Invitrogen, 36-4500), CRABP2 (mouse ...
-
bioRxiv - Neuroscience 2024Quote: ... CD31 (Thermo Fisher, Cat#11–0311), CD140a (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... CD45 (Thermo Fisher, Cat#11–0451), CD31 (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... were stained with 1µM (MOLM-13 and MV-4-11) or 3µM (HL-60) CellTrace Far Red (Thermo Fisher Scientific) to monitor cell divisions ...
-
bioRxiv - Biophysics 2021Quote: ... DNA quality was determined by 260nm/230nm and 260nm/280nm ratios on a DS-11+ spectrophotometer (DeNovix) and concentration was determined using the Qubit 3 (Thermo Scientific). Pooled samples were sent to GeneWiz where they were analyzed by TapeStation (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... Aliquots of 15 μg of total protein extract from each sample (3 strains x 4 conditions x 3 replicates) and the three bulks were separated on onedimensional SDS-PAGE short-migration gels (11×1 cm lanes, Invitrogen, NP321BOX). Yeast proteins digestion was performed on excised bands from gel gradient and digested peptides of UPS2 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse transfected with 1 pmol/well of a combination of 3 non-overlapping 11-mer siRNAs (Ambion Silencer® Select, Thermofisher) using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2021Quote: ... 5 mM Aminoguanidine and 2.5 mM Sodium Ascorbate the reaction allowed to proceed for 6h at room temperature before removal of the biotin excess using Zeba desalting columns (7kDa cut-off, Thermofisher). The samples were then combined altogether at a 1:1:1 ratio within one replicate ...
-
bioRxiv - Genomics 2024Quote: ... Cells were harvested for RNA extraction at 6h and 24h from unstimulated and stimulated PBMCs using TRIzol® (Life technologies) reagent according to manufacturer’s instructions and treated with DNase to ensure elimination of genomic DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 µL of the reaction was stopped with 9 µL NuPAGE LDS Sample Buffer (Invitrogen) at 0 ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... buffer B (5 mM Tris-HCl pH 8.0, 10 mM MgCl2, 1 mM EDTA; Ambion), BSA-biotin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... isolated B cells were stained with Cell Proliferation Dye eFluor™ 670 (5 μM, Invitrogen) and measured after 48 and 96 h.
-
bioRxiv - Biophysics 2020Quote: ... and 5 mL of B-PER™ complete bacterial protein extraction reagent (Thermo Scientific #89821) with 2 mM MgCl2 ...
-
bioRxiv - Immunology 2023Quote: ... B-cells were cultured at 37 °C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... from 5-30% solvent B (LC-MS grade 0.1% formic acid (#A117, Thermo Fisher Scientific) and acetonitrile ...
-
bioRxiv - Bioengineering 2023Quote: ... 100 µg/mL)-coated 6-well plates in hECSR medium (Human Endothelial SFM, Thermo Fisher, cat# 11111-044; B-27 Supplement (50×), Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All samples were counterstained in 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D1306) for 10 minutes at room-temperature and mounted in ProLong Gold Antifade (Thermo fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were labelled using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) and coverslipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Life Technologies) at a dilution of 1:5000 in 1 X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’ ,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... Nuclei were then stained with DAPI (4’,6- diamidino-2-phenylindole, dihydrochloride, ThermoFisher, 62247 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei and finally washed with PBS.
-
bioRxiv - Cancer Biology 2021Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) at 1 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were staining with DAPI (4′,6-diamidino-2-phnylindole) from Molecular Probes. Confocal images were acquired using a Leica Sp8 confocal microscope and processed using Imaris image analysis software (version 9.3.1).
-
bioRxiv - Cancer Biology 2022Quote: ... sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH; 22589, Thermo Fisher Scientific), 3-(Acryloyloxy)propyltrimethoxysilane (L16400 ...
-
bioRxiv - Immunology 2022Quote: ... Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) dihydrochloride (Life Technologies), and lung sections were mounted on glass microscopy slides using fluorescence mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2020Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, 0.1 μg/mL; #D1306, Invitrogen) and mounted with Prolong Gold antifade medium (#P10144 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) to visualize the nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4′,6-diamidino-2-pheny-lindoldihydrochloride (DAPI, Thermo Fisher Scientific #D3571) diluted in DPBS for 10 minutes ...