Labshake search
Citations for Thermo Fisher :
8801 - 8850 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... APC was separated by Tris-Acetate 3-8% precast gels (NuPAGE Novex, Invitrogen). The proteins were transferred into nitrocellulose membranes by electrophoretic transfer.
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-rabbit Alexa 647 (Invitrogen, Waltham, MA; for N = 3 birds). After 3 more washes in 0.1 % PBT ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 3 washes in 0.22μm filtered PBS (Thermo Fisher Scientific, MA, USA). Excess PBS was removed by placing a piece of absorbent paper at the edge of the grid ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 3% FBS (heat-inactivated fetal bovine serum; Thermo Fisher Scientific, Poland) and streptomycin (100 μg/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... Calu-3 cells were cultured for RNA isolation using Trizol reagent (Invitrogen, USA) following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed 3 times with PBS and then lysed using Trizol (Thermofisher) before analysis by qRT-PCR for viral RNA detection as previously described (Monteil et al ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: ... We use Pierce ECL Plus Western Blotting Substrate (Thermo Fisher Scientific # 32132×3) as developing reagent ...
-
bioRxiv - Cancer Biology 2020Quote: ... drug selected pcDNATM 3 with 111μg/mL G418 Sulfate (Genticin) (Thermo Fisher Scientific). All N/Tert-1 cells were grown in keratinocyte serum-free medium (K-SFM;Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Pooled populations were selected for 3 days with puromycin (2ug/ml, Life Technologies) and used for experiments 7-9 days post transduction with gRNA ...
-
bioRxiv - Biophysics 2020Quote: ... the supernatant was mixed with 3 mL of NiNTA resin (Thermo Scientific 88222) and incubated for 1 hour at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... and 0.01% Oregon Green DHPE (1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine, ThermoFisher, O12650) for the lipid diffusion experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells (3 x 105) were seeded on coverslips in 48-well plates (Nunc), allowed to attach overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... in a QuantStudio 3 Real-Time PCR Systems (Thermo Fisher Scientific, Waltham, MA). The sequence of the primers (18S ...
-
bioRxiv - Neuroscience 2022Quote: ... Live cell density was determined using the Countess 3 automated cell counter (ThermoFisher) and cells were plated onto 8 well chamber slides at a density of 43,000 cells/cm2 and cultured in an incubator at 37 °C / 5 % CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were split 1:10 every 3 days by using trypsin (Gibco, 25200072).
-
bioRxiv - Pathology 2022Quote: ... VSMCs (n = 3) were lysed using Pierce immunoprecipitation lysis buffer (Thermo Scientific, 87788) supplemented with protease inhibitor ...
-
bioRxiv - Cancer Biology 2022Quote: ... we validated the expression changes using qRT-PCR (QuantStudio 3, Applied Biosystems, USA). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (MTT) (M6494, Thermo Fisher Scientific) was added to each well to a final concentration of 0.67 mg/ml and incubated at 37oC ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantification was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The average change in threshold cycle (ΔCt ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell nuclei were detected with TO-PRO-3 (1:400; Thermo Fisher Scientific). To analyze PNN structure and to detect synaptic proteins ...
-
bioRxiv - Genomics 2022Quote: ... The cell pellet was resuspended in 3 ml ACK buffer (Thermo Fisher; #A1049201) to lyse red blood cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... After 3 washes with Ca2+-Mg2+ free Dulbecco Phosphate Buffered Saline (DPBS, Gibco), wells were blocked with 5% non-fat dry milk in Tris Buffered Saline (TBS ...
-
bioRxiv - Microbiology 2022Quote: ... Purified CD4+T cells were washed and stained with 3 µM CFSE (Invitrogen). Cells were washed ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μL of sample was applied to an Amid-HILIC column (Thermo Fisher Scientific Accucore 150 Amid-HILIC ...
-
bioRxiv - Cell Biology 2022Quote: ... Alexa-Fluor®-labelled phalloidin and TO-PRO-3 were obtained from Invitrogen. DAPI was obtained from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2021Quote: ... samples were then incubated with TO-PRO-3 (Thermo Fisher, T3605, 1:300), goat anti-rat Alexa Fluor 568 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were blocked in PBS containing 3% Bovine Serum Albumin (BSA; Acros Organics) for 30 min before incubated with Alexa-647 for 1h at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’adaptor-ligated RNA was resolved on a 15% TBE-urea gel (Invitrogen) and the RNA in the size of 54–75 nt for input and 48-54 nt for RPF was purified ...
-
bioRxiv - Neuroscience 2021Quote: ... A final incubation of 3 min with DAPI (1:1000, Thermo Fisher Scientific) was done ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes were coated with DiI (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate, Invitrogen, USA) for post-hoc recovery of the recording location (see below) ...
-
bioRxiv - Plant Biology 2021Quote: ... Concentrations were measured on a Qubit 3 fluorometer (Thermo Fisher Scientific, Waltham, US) and fragment length distribution was checked with the QIAxcel (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated dextran amine tracer (BDA; 3 kD version; Life Technologies Ltd, Paisley, UK), and (iv ...
-
bioRxiv - Plant Biology 2021Quote: ... on a QuantStudio 3 Real-time PCR System (Thermo Fisher Scientific, Inc., USA). To quantify P ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2021Quote: ... followed by DNA staining with 1 µM TOPRO-3 iodide (642/661; Invitrogen) and staining of the fungal hyphae with 100 μg/ml Fluorescent Brightener 28 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected with Blasticidin (3 μg/ml) (Gibco, Cat. A11139-03) and Puromycin (1.5 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by TEV cleavage using 3 ul of AcTEV protease (Invitrogen, # 12575-015) in 160 ul of TEV cleavage buffer with constant rotation at 16°C for 90 minutes ...
-
bioRxiv - Physiology 2021Quote: ... TO-PRO-3 Cy5 was obtained from Molecular Probes (ThermoFisher, Grand Island, NY). Immunolabeled tissues were mounted in mounting medium (Vector Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... At DIV 3 the medium was changed to Neurobasal medium (Thermo Fisher Scientific) supplemented with B-27 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Cdc7-HA were resolved on 3-8% Tris-Acetate gels (Invitrogen EA0375) at 150V for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... and blocking solution (PBS with 0.1% triton, 3% normal donkey serum; Fisher Scientific). Immunohistochemical and immunofluorescent staining ...
-
bioRxiv - Immunology 2020Quote: ... 4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY™-C16, Invitrogen, 1μM, 30min) or kynurenine (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... A PGC LC column (3 μm, 100 mm × 0.18 mm, Hypercarb, Thermo Scientific) was maintained at room temperature and at 50°C ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed 3 times with hepatocyte wash medium (Thermo Fisher Scientific, 17704024). Cells were then plated in a 6-well plate precoated with collagen I (50μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Cell cultures at 3 × 106/ml were transiently transfected using Expifectamine (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...