Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% Donkey Serum, 1% Triton-100, 1h) followed by primary (overnight, 4°C) and secondary antibodies (1-2h, Jackson ImmunoResearch or ThermoFisher Scientific) incubation ...
-
bioRxiv - Neuroscience 2020Quote: ... were quantified in autaptic neuronal cultures using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43, Thermo Fisher Scientific, Waltham, MA, USA), similarly as in our previous report (Kawano et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were visualized using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43FX, a fixable analog of FM1-43 membrane stain, Thermo Fisher Scientific, Waltham, MA, USA). To stain the presynaptically active synapses of autaptic cultured neurons ...
-
bioRxiv - Neuroscience 2019Quote: ... they were incubated with donkey anti-chicken rhodamine and donkey anti-rabbit Alexa 488 secondary antibodies for 1.5 hours and then with 1 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen Life Technologies) (1:20 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell nuclei were stained for 30 min with 4’,6-diamidino-2-fenylindool (DAPI, 1:1000 in PBS, Thermo Fisher Scientific). After immunolabelling ...
-
bioRxiv - Plant Biology 2021Quote: ... Tissues were counterstained with DAPI (4′,6-diamidino-2-phenylindole, 1 μg/ml in PBS) and mounted with ProLong Gold (ThermoFisher Scientific) using #1.5 coverslips (thickness ...
-
bioRxiv - Microbiology 2020Quote: ... Light organs were then counterstained overnight with a 1:750 dilution of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) in 5x SSC-Tween before mounting on slides with Vectashield (Vector Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... All slides were then rinsed three times with PBS-T and twice with 1× PBS and coated with 4’,6-diamidino-2-phenylindole (DAPI) containing the antifade reagent ProlongGold (Life Technologies). Images were acquired using an Olympus BX63 automated fluorescence microscope equipped with an Olympus DP74 digital camera and evaluated with cellSens Dimension software (Olympus).
-
bioRxiv - Biochemistry 2020Quote: ... at 37°C for 20 min and stained with DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate, 1:1000 in PBS, pH 7.4, Thermo Fisher Scientific) before imaging on a Nikon Eclipse Ti-E inverted microscope with a 100X lens (Apochromat 1.49 Oil 0.13-0.20 DIC N2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gonads were washed 3 times and then stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI) before mounting with antifade solution (Invitrogen, P36980) on poly-L-lysine coated glass slides (Sigma Merck ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by washing and addition of secondary antibodies and 4′,6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific, 62248) for 30 mins ...
-
bioRxiv - Bioengineering 2023Quote: ... to each well we add 200 μL of 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Cat. No. D3571) solution in DI water ...
-
bioRxiv - Systems Biology 2023Quote: ... the cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Thermo Fisher Scientific, Waltham, MA, USA) in PBS for 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... sections were counterstained with 1 µg/ml of 4’,6-diamidino-2-phenylindole (DAPI, #D1306, Thermo Fisher Scientific, Waltham, MA, USA) then ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37°C ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... with 3 μL of Syto 9 and Propidium iodide (PI) dyes (ThermoFisher Scientific, USA) 1000-fold diluted in PBS (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... a 3 µL aliquote was mixed with 9 µL NuPAGE LDS sample buffer (Invitrogen) and heated at 95 °C for 2 min to stop the reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated with primary antibodies in 10% NGS/NDS in PBST over night at 4°C following 1h incubation at 24°C with appropriate Alexa488/568 coupled secondary antibodies (1:1000, Invitrogen). Cell nuclei were stained with DAPI and final images were acquired using Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Plant Biology 2021Quote: ... protoplasts were resuspended in lysis buffer (45mM magnesium chloride, 30mM sodium citrate, 20mM MOPS, 0.5% triton, 2% 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific), pH 7 ...
-
bioRxiv - Microbiology 2019Quote: ... and 2 μl of 1 μM ToPro 3 (Molecular Probes T-3605), a nucleic acid dye that only permeates cell membranes of dead cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells from 2-D or 3-D cultures were harvested from one well of a 6-well plate and dissociated with Accutase (Thermo Fisher #A1110501), washed three times with 1x PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Immunology 2024Quote: WT and Tlr2/4/9 -/- iBMDM were lysed in TRIzol reagent (Thermo Fisher) and RNA extraction was performed according to manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibody (2-3% serum, 0.4% PBST, 1:500 Invitrogen A11035, 1:500 DAPI) was applied and incubated for one hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with Alexa-Flour-488 or 555 secondary antibodies (1:1000) along with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Camarillo, CA, 1:1000) for 1 hr at room temperature (RT) ...
-
bioRxiv - Cell Biology 2019Quote: ... For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific, Life Technologies).
-
bioRxiv - Cell Biology 2019Quote: ... For differentiation cells were switched to M254 medium for 3-4 population doublings (ThermoFisher Scientific, Life Technologies).
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged after reaching 70-85% confluency (every 3-4 days) using Accutase (Gibco #A11105-01) to disperse into single cells and replated in mTeSR1 supplemented with 1% P/S containing 10 µM Rock Inhibitor (Y-27632 ...