Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... cells were stained with 300 nM 4’,6-diamidino-2-phenylindole (DAPI; D1306, Invitrogen) for 5 min at RT ...
-
bioRxiv - Immunology 2020Quote: PBMC (1-2*10^6 cells) and pDC (1-4*10^4) were maintained for 16 h in RPMI1640+10% FBS+ 1% (PS) (Gibco Laboratories) in 96 well round bottom plates ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies overnight at 4°C and then incubated for an additional 3 hours at 4°C with 50 μL DynabeadsTM protein G (Life Technologies, 10004D). Following three washes with 1% Triton-TBS lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:3 or 1:4 before mixing with Power SYBR Green PCR Master Mix (CAS: 4368702, Applied Biosystems) and primer pairs (Table S4B) ...
-
bioRxiv - Bioengineering 2021Quote: ... and Beefy-9 media were fixed with 4% paraformaldehyde (ThermoFisher #AAJ61899AK) for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 1% Penicillin/Streptomycin/L-Glutamate (P/S/G ...
-
bioRxiv - Microbiology 2022Quote: ... incubated for 10 min in the dark at room temperature with FM 4-64FX (3 μg ml-1) (ThermoFisher). Cells were applied to a 5% agarose pad containing M9 minimal media with glucose (0.4%) ...
-
bioRxiv - Genetics 2022Quote: Immunoprecipitations were performed using 1 μg of Anti-Trimethyl-Histone-3-Lys-4 (-Thermo Fisher Scientific; catalog# PA5-17420) overnight at 4 ◦ C ...
-
bioRxiv - Neuroscience 2022Quote: 100 to 150 3-dpf zebrafish larvae were bathed in Yo-Pro-1 (4 µM, 30 min) (Invitrogen, Y3603), then washed 3 times in blue water to label lateral line hair cells ...
-
bioRxiv - Immunology 2023Quote: ... and packaging vector psPAX2 were mixed in a 4:3:1 ratio in OPTI-MEM (Thermo Fisher Scientific, 31985070) and PEI (Polysciences ...
-
bioRxiv - Physiology 2022Quote: ... Dionex Ionpac AG11-HC b (2 mm x 50 mm, 4 μm particle size, ThermoFisher Scientific), was placed before the separation column ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/mL TPO and 40 ng/mL IL-3 from day 1 to day 6 with a media refresh every 2 days (all cytokines from Thermofisher). On day 8 ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: N2A cells were transfected as described above with BicD2-KIF tail fusions and MBNL-GFP proteins at a ratio of 2:3 in 4-well chamber slides (Thermo Fisher, 154526). 24 hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... 4 µl of peptide mixtures were loaded onto an Acclaim PepMap precolumn (75 µm × 2 cm, 3 µm, 100 Å; Thermo Scientific) equilibrated in solvent A and separated at a constant flow rate of 250 nl/min on a PepMap RSLC C18 Easy-Spray column (75 µm × 50 cm ...
-
bioRxiv - Physiology 2023Quote: ... IALVs were then washed with PBS containing 0.1% Triton X-100 (PBST) 3 times and blocked for a minimum of 2 hr with Blockaid® (B-10710, ThermoFisher Scientific). IALVs were then stained with the corresponding primary antibodies in BlockAid® Solution ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended in MACS buffer containing 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies). A BD FACSAria III Cell Sorter (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Neuroscience 2019Quote: ... Lines were passaged every 3-4 days using enzymatic detachment with Stempro Accutase (ThermoFisher; A1110501) for 5 minutes and re-plated in mTeSR1 medium with 10µM Rock Inhibitor (Y2732 ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).