Labshake search
Citations for Thermo Fisher :
8351 - 8400 of 10000+ citations for Glutathione Fluorescent Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was synthesized from 1 μg of total RNA using the High Capacity cDNA Reverse Transcription Kit (Invitrogen), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA (5 ng µl−1) was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). 1 µl of cDNA was used as a template in a 10 µl qRT-PCR reaction performed with Power SYBR reagent (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was carried out with a Power SYBR Green RNA-to-Ct 1-Step Kit (Applied Biosystems). UBQ10 (AT4G05320 ...
-
bioRxiv - Cancer Biology 2020Quote: Nuclear fractions from ∼1×106 NCI-H2107 cells were prepared using the NE-PER kit (ThermoFisher Scientific 78835) as per the manufacturer’s instructions and incubated with 10 μg primary antibodies overnight at 4°C followed by 90 minutes incubation with 35 μl protein A/G agarose plus (50% slurry ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA was synthesized from 1 µg of RNA using the Maxima First Strand cDNA synthesis kit (Thermo Scientific) according to the manufacturer’s recommendations for high GC content templates.
-
bioRxiv - Cell Biology 2021Quote: ... cell lysates for qPCR were prepared using the Cells-to-CT 1-Step Taqman Kit (Invitrogen, cat# A25603) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA (1 μg) was converted to cDNA using the Verso cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA). All procedures were conducted according to the manufacturers’ suggestions.
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using SuperScript III First-Strand Synthesis kit (#18080051, Invitrogen) and random primers ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of total RNA per sample was treated with DNase I using the Turbo DNase kit (Ambion), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μl of TaqMan® RT-PCR mix (TaqMan® RNA-to-CtTM 1-Step Kit, Applied Biosystems), 0.5 μl of TaqMan® RT-Enzyme Mix ...
-
bioRxiv - Plant Biology 2021Quote: ... About 1 μg RNA was reverse-transcribed using the Maxima first-strand cDNA synthesis kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... reverse primer: CTAAACATAAAAGACTTGTCCAACG) on Col-0 cDNA synthetized from 1 µg RNA with SuperScript™ III kit (Invitrogen). Sequencing of PCR products (GATC Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were purified (Gene JET purification kit and Gene Ruler, 1-kb marker, Thermo Fisher Scientific) and then digested with appropriate restriction enzymes (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA was isolated using either 25:24:1 Phenol:chloroform:isoamylalcohol followed by ethanol precipitation or extracted using the GeneJet genomic DNA purification kit (ThermoFisher). For human colon organoids ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using 1 μg of RNA and a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... stained for 20 min in cold PBS with Fixable Violet Dead Cell Stain Kit (1/4000, Invitrogen, L34955) and washed in FACS Buffer (PBS 0.5% BSA 2 mM EDTA) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μg RNA was reverse transcribed by using the High-Capacity cDNA reverse transcription kit (Applied Biosystems #4368814), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 µg of RNA was reverse transcribed using High-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Massachusetts, USA) as mentioned previously [29] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Live/dead staining was performed using LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (1:1000 dilution, ThermoFisher). In this assay uptake by the following cell types was defined ...
-
bioRxiv - Neuroscience 2022Quote: 1 μg of RNA was then converted to cDNA using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1 μg) was used for cDNA synthesis with High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific). cDNA and primers were mixed with PowerUp SYBR green 2X master mix (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: The mitochondrial transmembrane potential was measured by incubating the cells for 30 min at 37 °C with 2 mM JC-1 red dye (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzim-idazolylcarbocyanine iodide) using the MitoProbe JC-1 assay kit (Molecular Probes, USA). Mitochondrial depolarization is indicated by a decrease in the red/green fluorescence intensity ratio ...
-
bioRxiv - Neuroscience 2020Quote: ... The supernatant was diluted 1:100 and luminescence was monitored using an ATP determination kit (A22066, Molecular Probes). Luminescence readings for each sample were compared to an ATP standard curve and normalized to the total amount of protein determined using the Pierce BCA Protein Assay Kit (23225 ...
-
bioRxiv - Immunology 2020Quote: ... 1 x 106 cells were labelled with the LIVE/DEAD Fixable Blue Dead Cell Stain kit (Thermo Scientific) at 1:1000 dilution in 1 mL of HBSS for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7.5-10 μg of total RNA were loaded onto a 1% agarose denaturing gel (Northern Max Kit, Invitrogen) and electrophoresed at 90 V for 3 hr ...
-
bioRxiv - Pathology 2022Quote: ... SYTOX® Green Dead Cell stain (S34860) and JC-1 kit (T3168) were provided by Invitrogen (United States).
-
bioRxiv - Physiology 2022Quote: ... 1 µg of RNA was converted to cDNA using the High-capacity cDNA Reverse Transcription kit (Applied Biosystems) and diluted to 1:100 ...
-
bioRxiv - Microbiology 2019Quote: Total RNA (1 μ.g) was reversed transcribed using the high capacity RNA to cDNA kit from Applied Biosystems. cDNA was diluted to a concentration of 10 μg/μl and amplified with specific primers in the presence of SYBR green (Applied Biosystems) ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... DNase-treated RNA (1 μg) was reverse-transcribed using a Superscript VILO cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 µg of total RNA was reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). qRT-PCR reactions were performed using SYBR green Mastermix (Applied Biosystems ...
-
bioRxiv - Pathology 2019Quote: ... and 0.5-1 µg was prepared for first-strand cDNA synthesis using the superscript synthesis kit (Invitrogen, USA) and quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was synthesized from 1 μg total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real time PCR was performed on Light Cycler 480 II instrument (Roche ...
-
bioRxiv - Zoology 2019Quote: ... Total RNA (1 μg) was then reverse transcribed using the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) and oligo(dT ...
-
bioRxiv - Cell Biology 2019Quote: β-galactosidase activity was analyzed in THP-1 cells and secreted proteins using the β-galactosidase assay kit (ThermoFisher) according to manufacturers instructions ...
-
bioRxiv - Genetics 2020Quote: ... We reverse transcribed 1 ug of total RNA into cDNA using the ABI kit (Life Technologies Cat # 4368814). We used two pairs of primers for IL7 and assays for three normalizing genes (HPRT ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA with a high- capacity cDNA reverse transcription kit (Applied Biosystems). Gene amplification was caried out using 4 μl from a 1:10 cDNA dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg of total RNA was used for cDNA synthesis using SuperScript III First-Strand kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA in situ hybridisation was performed using Invitrogen ViewRNA ISH Tissue 1-Plex Assay kit (Thermo Fisher Scientific) according to the manual protocol (https://www.thermofisher.com/document-connect/document-connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-Assets%2FLSG%2Fmanuals%2FMAN0018633_viewRNA_ISH_UG.pdf&title=VXNlciBHdWlkZTogVmlld1JOQSBJU0ggVGlzc3VlIEFzc2F5) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was reverse transcribed from 1 μg of RNA through random hexamers using the SuperScript-III kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNAs were synthesized from 1 µg of total RNA using the High Capacity Reverse Transcription Kit (Applied Biosystems) and quantitative RT-PCR was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... and used as templates for the RT-qPCR analysis by Verso 1-Step RT-qPCR Kit (Thermo Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... the cDNA was synthesized from 1 μg of total RNA using a reverse transcriptase kit (Invitrogen, Carlsbad, CA) with an oligo-dT primer ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg of total RNA was used for cDNA synthesis using the M-MLV reverse Transcriptase Kit (Invitrogen) and an oligo(dT ...
-
bioRxiv - Immunology 2021Quote: ... and used as templates for the qRT-PCR analysis by Verso 1-Step qRT-PCR Kit (Thermo Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 mL of the homogenate was used as input for the PureLink RNA Mini Kit (Life Technologies, 12183018A). RNA extraction was then conducted according to the manufacturer’s guidelines.
-
bioRxiv - Neuroscience 2021Quote: ... the cells were incubated for 30 min at 37°C with 2 mM JC-1 red dye (5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolylcarbocyanine iodide) using the MitoProbe JC-1 assay kit (Molecular Probes, USA). CCCP (carbonyl cyanide 3-chlorophenylhydrazone ...
-
bioRxiv - Genomics 2020Quote: Cells were stained with calcein-AM and ethidium homodimer-1 (LIVE/DEAD® Viability/Cytotoxicity Kit, ThermoFisher L3224) and individual live cells were sorted in 384 well lysis plates using SONY sorter (SH800S ...
-
bioRxiv - Molecular Biology 2021Quote: 1 μg 18S IVT was polyadenylated with a E-PAP based Poly(A) Tailing Kit (Thermo Fisher Scientific) according to the manufacturers instructions and purified using RNA Clean and Concentrator kit (Zymo Research).
-
bioRxiv - Biophysics 2022Quote: ... The real-time PCR reactions were performed with the TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems) by preparing samples as follows (total 10 μl reaction) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA synthesis was carried out using 1 μg total RNA using high-capacity cDNA synthesis kit (Applied Biosystems). Subsequently ...