Labshake search
Citations for Thermo Fisher :
8051 - 8100 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... for the detection of Aβ or AT-8 (1:1000, Cat# AB_223647, Thermofisher) for phospho-tau and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies were detected using ECL Western Blotting Detection Reagent (ThermoFisher Scientific; 34076). Membranes were then stripped using Restore™ PLUS Western Blot Stripping Buffer (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Detection of chemiluminescence was carried out using SuperSignal West Pico PLUS (Thermo Scientific) or PierceTM ECL reagent (Thermo Scientific) ...
-
bioRxiv - Physiology 2024Quote: ... Chemiluminescence detection was performed using Pierce ECL Western blotting substrate (Thermo Fisher Scientific), and the resulting images were captured with an Ez-Capture MG system (Atto Co. ...
-
bioRxiv - Developmental Biology 2024Quote: ... The blots were assayed by an ECL-based detection method (Thermofisher cat#34579). The images were captured under the Bio-Rad ChemiDoc system using the optimal autoexposure settings.
-
bioRxiv - Cell Biology 2024Quote: ... Detection was performed using HRP-conjugated secondary antibodies (1:6,000 dilution, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The signal was detected with a chemiluminescence detection system (Thermo Scientific, Waltham, MA). Blots were imaged with an iBright CL1500 Imaging System (Thermo Fisher Scientific Inc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Immunoblot signals were detected using an ECL detection reagent (Thermo Fisher Scientific, 34577).
-
bioRxiv - Neuroscience 2024Quote: ... The target bands were developed by enhanced chemiluminescence detection reagents (ThermoFisher; 34095 & 34580) and detected on the iBright 1500 Imaging System (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... Detection was performed using Pierce™ ECL Western Blotting Substrate (ThermoFisher Scientific, #32209) and either X-ray blue films ...
-
bioRxiv - Bioengineering 2024Quote: ... The protein bands were developed using enhanced chemiluminescence detection reagent (Thermo Fisher Scientific) and imaged using a ChemiDoc MP imaging system (BioRad) ...
-
bioRxiv - Immunology 2021Quote: ... The plates were read at 450 nm on a VarioSkan Plate Reader (Thermo Fisher Scientific) within 10 minutes of adding stop solution.
-
bioRxiv - Immunology 2021Quote: ... The plates were read at 450 nm on a VarioSkan Plate Reader (Thermo Fisher Scientific) within 10 minutes of adding stop solution.
-
bioRxiv - Microbiology 2019Quote: ... Ninety-six-well plates (MicroAmp EnduratePlate Optical 96-well fast clear reaction plates; Applied Biosystems) were used and heated from 25 to 95°C with a ramp rate of 0.05°C/s and read by a thermocycler (QuantumStudio 5 real-time PCR system ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each well of the microtiter plate (MicroAmp fast optical 96-well reaction plate, Applied Biosystems) was filled with 20 µL of final solution ...
-
bioRxiv - Immunology 2024Quote: ... All plates were read on a MultiSkan Sky ELISA plate reader (ThermoFisher Scientific MA USA) at 492 nm ...
-
bioRxiv - Neuroscience 2022Quote: Plates were transported from plate hotels using a CRS CataLyst Express robot from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The plate was analyzed every hour using a Multiskan FC plate reader (Thermo Fisher Scientific), and absorbance was measured at 620 nm.
-
bioRxiv - Neuroscience 2022Quote: Assay plates (Nunc™ MaxiSorp™ 96-well polystyrene plate catalog #449824; Thermo Fisher Scientific) were coated with 100 μL/well of the capture antibody (2B7 or anti-PP2A ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were cultured in 96-well plates using a spectrophotometer plate reader (Thermo Fisher Scientific) with antibiotic concentrations ranging from 0.25 μg/mL to 2048 μg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... The plate absorbance was measured by a plate reader at 450nm (Multiscan Sky, Thermo Scientific). The number of epitopes was calculated by comparison with a calibration line obtained using rabbit red blood cells [27].
-
bioRxiv - Bioengineering 2023Quote: ... The plate absorbance was measured by a plate reader at 450nm (Multiscan Sky, Thermo Scientific).
-
bioRxiv - Plant Biology 2023Quote: After coating of the 96-well plates (Nunc-Immuno® Plates, Thermo Scientific, Waltham, USA) with 100 µl per well of the sample in triplicate in different concentrations in ddH2O (12.5 µg mL-1 for AmOx and KOH ...
-
bioRxiv - Immunology 2024Quote: ... Antigen-coated plates were centrifuged briefly at approximately 2,000xg in a plate spinner (Fisher Scientific) to ensure even coating then incubated on a rocker at 4°C (minimum 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Molecular Biology 2021Quote: The experiments aiming for high resolution and high mass accuracy in this study were done on a LTQ Orbitrap XL ETD mass spectrometer (Thermo Fisher Scientific) equipped with standard ESI ion source ...
-
bioRxiv - Neuroscience 2020Quote: ... LC-MS was performed using Ulimate3000 ultra high-performance liquid chromatography system and Q Exactive four-stage pole orbital well high-resolution mass spectrometer (Thermo Fisher Scientific). The internal standard was from the Institute for Food and Drug Control (Beijing ...
-
bioRxiv - Neuroscience 2022Quote: The proteomics was performed by the serum after removing common high-abundance protein through using a Thermo Fisher’s serum High Abundance protein removal reag ent (High Select™ Top14 Abundant Protein Depletion Mini Spin Columns, A36370, Thermo fisher, US). The mass spectrometer Thermo Scientific Q Exactive was perfor med for Label-free quantification detection and data was analyzed by Proteome Disco verer 2.2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled with an Orbitrap Eclipse™ Tribrid™ Mass Spectrometer via an EASY-spray (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled with an Orbitrap Eclipse™ Tribrid™ Mass Spectrometer via an EASY-spray (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: Templates for riboprobe synthesis were generated by TA-mediated cloning of pre-amplified cDNA sequences (Q5 High-Fidelity DNA Polymerase, New England Biolabs, Germany & AccuPrime Taq DNA Polymerase, High Fidelity, Thermo Fisher Scientific) with an average length of 400-500 bp ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a tims3 TOF Pro (Bruker ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a timsTOF Pro (Bruker ...
-
bioRxiv - Biochemistry 2023Quote: Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled with an Orbitrap Eclipse™ Tribrid™ Mass Spectrometer via an EASY-spray (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both total proteome and phosphoproteome were analysed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography system (Thermo Fisher Scientific) coupled with an Orbitrap Eclipse™ Tribrid™ Mass Spectrometer via an EASY-spray (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were analyzed by high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled with a Thermo Orbitrap Eclipse™ Tribrid™ Mass Spectrometer via an EASY-spray (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were analyzed on high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a timsTOF Pro (Bruker ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were analyzed on high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a timsTOF Pro (Bruker ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were analyzed on high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a timsTOF Pro (Bruker ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were analyzed on high-resolution LC-MS/MS using an Ultimate 3000 Nano Ultra High-Pressure Chromatography (UPLC) system (Thermo Fisher Scientific) coupled to a timsTOF Pro (Bruker ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... Clones were scraped off the LB plates and plasmid DNA was extracted using PureLink™ HiPure Plasmid Maxiprep Kit (ThermoFisher, K210007). The libraries were submitted for next generation sequencing to confirm the coverage and diversity of gRNA and shRNA libraries ...
-
bioRxiv - Genomics 2020Quote: ... Cells were sorted with a BD Influx Sorter into 96-well plates and lysed using the Arcturus PicoPure Kit (Applied Biosystems) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Transformed cells were recovered in S.O.C media (from ElectroMAX Stabl4 kit) for 1h and spread on Luria–Bertani agar plates (245×245 mm, Thermo Fisher Scientific) containing 100 µg/mL ampicillin ...
-
bioRxiv - Microbiology 2022Quote: HK1 grown in 100 mm plates were transfected with 5 μg of RFP-LMP1 or GFP-PD-L1 plasmid using Lipofectamine 3000 transfection kit (Invitrogen, L3000015). Lipofectamine reagents were diluted in Opti-MEM medium (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Total protein content was determined by the Lowry method (77) adapted to a 96-well plate assay with the Microplate BCA Protein Assay Kit (23252, Thermo Scientific), using bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2020Quote: Single cells were sorted in 96-well PCR plates in 9 µl of RT/pre-amp mix from the CellsDirect One-Step qRT-PCR Kit (Life Technologies) and were kept at −80°C at least overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting amplification products were verified by gel electrophoresis and cleaning and normalization of individual PCR products was performed with SequalPrep™ Normalization Plate (96) Kit (Invitrogen). The normalized PCR amplicons were mixed ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA amplicons in each PCR reaction was normalized using the SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, catalog no. A1051001). The normalized reactions were pooled and quantified using the Kapa Biosystems Library qPCR MasterMix (ROX Low ...
-
bioRxiv - Cell Biology 2019Quote: ... The incubation and cycling conditions were set as described in the kit and the plates were analysed in a StepOnePlus Real-Time PCR System (Thermo Scientific).
-
bioRxiv - Pathology 2021Quote: ... Cells grown for 24h in 6-well plates were transfected with 1 μg of cDNA construct (Asic2b or t-Asic2b) using a Lipofectamine™ Plus kit (Invitrogen) according to the manufacturer’s protocol ...