Labshake search
Citations for Thermo Fisher :
8251 - 8300 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Blots were incubated for 5 minutes with 1 ml of Supersignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095) and imaged using the ‘chemi high-resolution’ setting on a Bio-Rad ChemiDoc MP System.
-
bioRxiv - Molecular Biology 2023Quote: ... Blots were incubated for 5 minutes with 1 ml of Supersignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095) and the final blot were imaged using the ‘chemi high-resolution’ setting on a Bio-Rad ChemiDoc MP System.
-
bioRxiv - Molecular Biology 2023Quote: ... Western Blotting Luminol Reagent (sc-2048, SantaCruz Technology, USA) or SuperSignal West Atto Ultimate Sensitivity Substrate (A38554, Thermo Fisher, USA) was used to develop signals ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-mouse IgG HRP-linked whole Ab (1:10000 dilution, Amersham, NA931) for 1 h and detected using SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher).
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized by incubating RNA for 2 h at 37 C using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Afterwards ...
-
bioRxiv - Evolutionary Biology 2020Quote: The same amount of mutant and WT RNA was used to synthetize cDNA with High Capacity cDNA Reverse Transcript kit (Applied biosystems-Thermo Fisher Scientific, cat. 4368814). A total of four different samples (4 mutant and 4 WT ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was synthesized from 500 ng of total RNA using a High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems by Thermo Fisher Scientific). For measurement of the mRNA levels of Arnt-2(Cat# Mm00476009_m1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-2 μg of total RNA was used for synthesizing cDNA with High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was then used for Q-PCR in a StepOnePlusTM (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Equal quantities of RNA from each subject were used to synthesize cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Aliquots of cDNA from each subject were pooled for use as standards to generate a calibration curve according to the relative standard curve method (http://www.AppliedBiosystems.com) ...
-
bioRxiv - Plant Biology 2020Quote: ... 250ng of total RNA was used for first-strand cDNA synthesis with the High capacity cDNA Transcription Kit (Applied Biosystems, ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2020Quote: cDNA was synthesized from 2 μg of RNA using random primers in 20 μL reaction with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... First-strand cDNA was synthesized from 2 µg of RNAusing High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, United States). RT-qPCR was done using PowerUp™SYBR™Green Master Mix (Applied Biosystems ...
-
Telomerase deficiency in humans is associated with systemic age-related changes in energy metabolismbioRxiv - Cell Biology 2022Quote: ... 1ug of DNAse 1 treated RNA was reverse-transcribed into first-strand cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primer sequences and thermal cycling parameters used to quantify fully spliced hTERT (primer set E4-E5 ...
-
bioRxiv - Neuroscience 2020Quote: 500 ng of total RNA were reverse transcribed by using random primers and the “High Capacity RNA-to-cDNA” kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A total of 800 ng of RNA was used to synthesize cDNAusing the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized from total RNA using High-Capacity cDNA Reverse Transcription kit with RNase inhibitor (Applied Biosystems, Cat No.4374966 Foster City, CA, USA). For the qPCR reaction mix ...
-
bioRxiv - Immunology 2019Quote: ... RNA concentration was adjusted to 50ng/μl and cDNA synthesis was performed using the High capacity cDNA Reverse Transcription kit (Applied Biosystems, Thermo Fisher Scientific, Warrington, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and single-stranded cDNA was synthesized by reverse transcription of total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Real-time quantitative reverse transcription PCR (real-time RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... and the complementary DNA (cDNA) was prepared from the RNA template using High-Capacity cDNA Reverse Transcription Kit TM (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Biochemistry 2019Quote: ... A sample corresponding to 1 µg RNA from each sample was used to perform cDNA synthesis by the High-Capacity cDNA Reverse Transcription Kit ® (Applied Biosystems, Foster City, CA). QPCR were performed using 0.4 ng/µL cDNA and 240 nM of each primer ...
-
bioRxiv - Plant Biology 2019Quote: ... 500 ng of total RNA was converted into cDNA in a 20 μl reaction using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life technologies, Thermo Fisher Scientific) according to manufacturer's instructions and subsequently 1/5 diluted in sterile RNAse and DNAse free water ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA samples (up to 1 μg) were reverse transcribed using the oligo(dT) primer from the High Capacity cDNA Reversion Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). mRNA expression of the TAM receptors Tyro-3 (Tyro-3) ...
-
bioRxiv - Cell Biology 2021Quote: The RNA was quantified with a Nanodrop and cDNA transcribed with the Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit (Fisher Scientific #43-688-14).
-
bioRxiv - Developmental Biology 2021Quote: ... a total of 200 ng of total RNA was reverse-transcribed into cDNA using High Capacity cDNA Archive Kit (Invitrogen Life Technologies; Cat-No. 4374966). Quantitative PCR (qPCR ...
-
bioRxiv - Plant Biology 2022Quote: ... one μg of RNA was used to prepare cDNA with the “High capacity RNA–to-cDNA” kit (#4387406 Applied biosystems-ThermoFisher Scientific, Waltham, Massachusetts, US). The qPCR analysis of the total cDNA was performed using the “Fast SYBR Green Master Mix “(# 4385612 Applied biosystems-ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... labeled peptides on one spin tip from a High-Select™ TiO2 Phosphopeptide Enrichment Kit (capacity of 1–3 mg; Thermo Fisher Scientific, catalog A32993). After preparing spin tips ...
-
bioRxiv - Systems Biology 2022Quote: ... Quality check was followed by reverse transcription of 1 μg total RNA per reaction using High- Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Two μg of each RNA sample was used for single-strand complementary DNA synthesis using a High-capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... and 500 ng of total RNA was reverse transcribed to single-stranded cDNA using the High-Capacity cDNA Archive Kit (4368814, Applied Biosystems, Foster City, CA, USA). Quantitative PCR was performed with LightCycler Fast Start DNA Master SYBR Green I (06924204001 ...
-
bioRxiv - Immunology 2023Quote: mRNA was extracted using Isogen II (Nippon gene, Tokyo, Japan) and cDNA was synthesized using a High-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The total RNAs were then converted to cDNA using a commercially available high-capacity cDNA Reverse Transcription Kit (Cat # 4368813, Applied Biosystems™, Foster City, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... A total of 500 ng of RNA was converted to cDNA using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA). The PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... A total of 1 μg of RNA per reaction was reverse-transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, 4368814). The following primers were used:
-
bioRxiv - Biophysics 2023Quote: Two µg of RNA were subjected to DNase digestion and reverse transcribed to cDNA using random hexamer primers and the High-Capacity cDNA Reverse Transcription Kit (both Thermo Fisher Scientific, Waltham, MA, USA). RT-qPCR was conducted on qTOWER³ 84 (Analytik Jena ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ten labeled samples in each of TMT 10-plex sets were pooled together and 80 µg of labeled tryptic peptides were then fractionated using a Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (Thermo-Fisher Scientific, San Jose, CA) with a 9-step isocratic elution ...
-
bioRxiv - Biochemistry 2024Quote: ... Mixed peptide samples were prepared from 6 µL of each sample and separated by high pH reversed phase peptide separation kit (Thermo Fisher Scientific, Waltham, MA, USA). Ten fractions were collected by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... Viral cDNA was prepared using 15 µL of viral RNA and random hexamers in a final volume of 30 µL using a High-Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA). The cDNA from all pooled samples were tested for influenza A viruses by RT-qPCR using TaqMan Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: 8 TMT reagents from a 10-plex reagent kit were used to label desalted peptides (Thermo Fisher) as directed by the manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: DNA was extracted from approximately 10 mg tissue using the PureLink Genomic DNA Mini Kit (Life Technologies). DNA quality control was performed using the Agilent 2200 TapeStation and the Genomic DNA ScreenTape kit to determine the DNA integrity number (DIN).
-
bioRxiv - Microbiology 2020Quote: ... for 10 minutes followed by total RNA isolation using the ToTALLY RNA total RNA Isolation kit (Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Up to 10 μg extracted RNA was DNase treated using the TURBO DNA-free kit (Applied Biosystems) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... TNFα and IL-10 levels were measured by TNFα Mouse Uncoated ELISA Kit (88-7324-86, Invitrogen) and IL-10 Mouse Uncoated ELISA Kit (88-7105-86 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A total of 10 µg of RNA was reverse-transcribed using Superscript IV Reverse-Transcription kit (Invitrogen) using an hTERT specific probe in exon-4 (CCTGACCTCTGCTTCCGACAG) ...
-
bioRxiv - Genomics 2019Quote: ... We extracted cfDNA from 10 ml urine using MagMAX Cell-Free DNA Isolation kit (Thermo Fisher Scientific) and eluted in 20-30 μl ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized from 10 ng of RNA using the Superscript III first strand synthesis kit (Invitrogen). The expression of rodA1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Poly(A)+ RNA was isolated from 10 ug total RNA using a Dynabeads mRNA isolation kit (Invitrogen), repeated twice to remove all residual rRNA contamination ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of purified RNA was analyzed for rRNA processing by Northern blot using NorthernMax kit (Invitrogen) and probes listed in Table S3.
-
bioRxiv - Microbiology 2023Quote: ... with 10 µl of each sample and 200 µl of Coomassie (Bradford) Protein Assay Kit (Thermo Scientific) and incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Tandem mass tag labeling (TMT) was performed using the TMT 10-plex reagent kit (ThermoFisher, Waltham, MA). Detailed methods of liquid chromatography-mass spectroscopy analysis is included in the Supplemental Material.
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of total RNA were reverse transcribed using a TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific) and RT specific primers for miRNAs (ThermoFisher Scientific ...