Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Immunology 2021Quote: ... 4°C) and cells were spun onto glass slides using a Cytospin 4 Cytocentrifuge (Thermo Scientific), dried for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar, Thermo Fisher Scientific, UK), followed by several washes in 0.1M Phosphate buffered saline (PBS ...
-
bioRxiv - Physiology 2023Quote: ... 0.5 mg protein was precleared for 30 minutes at 4°C with 4% Agarose beads (ThermoFisher). To immunoprecipitate RYR1 ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: 10 uL of either Caspase-3 or −7 library glycerol stocks was used to inoculate 5 mL of auto-induction media (Invitrogen Magic Media) and allowed to incubate and express for 18 hours at 30 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The same amount of protein lysate was aliquoted into different PCR tubes and simultaneously subjected to 6 different temperatures (37, 41, 45, 49, 53, 57 °C) for 3 min in the Veriti Thermal Cycler (Applied Biosystems). After 3 min cooling on ice ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... was added to cDNA and the DNA was denatured at 95°C for 3 min prior to loading in Novex 6% TBE-urea gel (Thermo Fisher). Samples were separated for 45 min at 180 V ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated at room temp in secondary antibodies (2h, streptavidin conjugated to Alexa Fluor 488 3:1000, ThermoFisher Scientific, Waltham, MA), and washed in PBS (overnight at 4°C) ...
-
bioRxiv - Bioengineering 2024Quote: ... and mixed with 3 µ L of DMRIE-C (Invitrogen). After incubation at room temperature for 45 min ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 7) and plunge-frozen at a condition of 95% humidity and 4°C by using a Vitrobot Mark IV (Thermo Fisher Scientific). The cryo-EM data were acquired with a Titan Krios at 300 kV (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... The grids were blotted using filter paper for 7 seconds at 4°C under 100% humidity using Vitro Mark IV (Thermo Fisher Scientific). Subsequently ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... and the supernatant centrifuged twice at 1000g for 10 min at 4°C (Sorvall RC-6 Plus Centrifuge, Thermo Scientific). The supernatant was centrifuged 8000g for 10 min at 4°C and then aspirated without disturbing the pellet ...
-
bioRxiv - Cell Biology 2023Quote: Binucleation analyses and detection of aberrant divisions were performed by heat-fixing cells on a microscope slide at 70 °C before staining with 4’,6-diamidino-2-phenylindole (DAPI) (SlowFade Diamond Antifade Mountant with DAPI, Invitrogen) and Calcofluor (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... One mg of total protein/sample were incubated for 6 h at 4°C with protein A/G-magnetic beads (Dynabeads, Invitrogen) prebound with 5 μg of the corresponding antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... One mg of total protein/sample were incubated for 6 h at 4°C with protein A/G-magnetic beads (Dynabeads, Invitrogen) prebound with 5 μg of anti-mCherry antibody ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: Colon crypts from 4 to 7 months old mice were isolated as described above and then resuspended in 4 ml of TryplExpress (ThermoFisher Scientific) for 15 min at 37°C under agitation at 75 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... with or without inhibitors at 4°C for 5 min and 37°C for 30 min in the presence of FM4-64FX (Thermo Fisher Scientific) to stain wounded cells ...
-
bioRxiv - Neuroscience 2022Quote: ... 72°C for 5 minutes and then held at 4°C in a Veriti™ 96-well thermal cycler (Applied Biosystems™). Adaptors from the LSK-109 sequencing kit (Nanopore ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml IL-4 (Life Technologies), and evaluated on day 6 of culture ...
-
bioRxiv - Microbiology 2022Quote: ... 4 µL linear acrylamide (5 mg/mL, ThermoFisher), and 1 mL of ice-cold 96% ethanol followed by overnight incubation at −20°C.
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5× phusion HF buffer (Thermo Scientific), 4 μL 5 M Betaine (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-cleaved-caspase-4/5 (Invitrogen, # PA5-39873),anti-cleaved caspase-3 (CST ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 µM di-4-ANEPPDHQ (Invitrogen, #D36802) in DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... HRP (ThermoFisher; 1:5000, 60 min at 4°C). Detection was achieved with Pierce™ ECL Western Blotting Substrate using a ChemDoc XR+ (BioRad).
-
bioRxiv - Cell Biology 2022Quote: ... 4 °C and normalized by BCA (Thermo Fisher Scientific) using BSA as standard ...
-
bioRxiv - Microbiology 2020Quote: ... overnight at 4°C and donkey anti-rabbit (ThermoFisher) (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C (Nunc MaxiSorp flat bottom, ThermoFisher Scientific). Coated plates were blocked with PBS containing 5% low-fat milk and 1% BSA for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... with 4 °C cold phosphate buffered saline (PBS, Gibco) and centrifuged at 4 C and 300 g ...
-
bioRxiv - Synthetic Biology 2024Quote: ... digested with AarI (Thermo Fisher; 4 h, 37 °C) and ligated into the previously digested backbone plasmid using a T4 ligase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated overnight at 4° C (MAP2 1:1000 Invitrogen #MA5-12826 ...
-
bioRxiv - Immunology 2024Quote: ... then transferred into 4°C Accutase digestion medium (Invitrogen) for one hour ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...