Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were resolved on NuPAGE 3-8% (wt/vol) Tris-acetate or 4-12% (wt/vol) Bis-Tris gels (Invitrogen) and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Developmental Biology 2023Quote: ... For differential glucose concentration treatments between day 2 and 3 and between day 3 and 4, N2B27 was made using DMEM/F12 without glucose (L0091-500, Biowest) and Neurobasal without glucose (A2477501, ThermoFisher). For 1X and 3X glucose concentrations ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells (human female in origin) were cultured every 3-4 days using 0.05% Trypsin EDTA and maintained in DMEM (Gibco, 11965118) supplemented with 10% heat inactivated fetal bovine serum (iFBS ...
-
bioRxiv - Immunology 2023Quote: Following euthanasia, adult zebrafish heads (15 wpf, N=3) were fixed in a solution of 4% methanol-free formaldehyde (Thermofisher) in 60 mM HEPES buffer (pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Media was partially renewed every 3-4 days with neuronal differentiation media 2 (NDM2: 1:1 DMEM/F12:NB (Gibco), glutamax (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Cell Biology 2024Quote: ... islets from 3-4-week-old control and β-LonP1KO mice were handpicked and then dispersed with trypsin (Thermo Scientific). Islet cells were counted and incubated with adenovirus expressing an empty vector control (Ad-RIP2 EV ...
-
bioRxiv - Cell Biology 2024Quote: ... 30 to 50 μg of protein extracts were resolved by SDS-polyacrylamide gel electrophoresis using 4–12% NuPAGE Bis-Tris gradient gel or 3–8% Tris-acetate gel and run (Invitrogen) and MOPS or Tris-acetate running buffer (Invitrogen ...
-
bioRxiv - Pathology 2024Quote: ... retinas were post-fixed in 4% PFA for 3 minutes at room temperature before mounting in Prolong Gold antifade medium (Invitrogen). Images were acquired using a Zeiss LSM710 and Zeiss LSM880 confocal microscope ...
-
bioRxiv - Developmental Biology 2024Quote: ... The 10µl of cells suspension infected with virus was plate micromass cultures (3-4 spots per 35mm culture dish, NUNC #150318) at a density of 2 x 107 cells/ml ...
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Cell Biology 2024Quote: ... red blood cells were removed by adding 1 ml ACK lysis buffer (150 mM NH4Cl and 10 mM KHCO3) and incubated on ice for 3 minutes before washing with HBSS containing 4% fetal bovine serum (HI FBS, Gibco). During the optimization of the protocol outlined above ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were usually passaged every 3-4 days in a 1:10 ratio using 0.05% (v/v) trypsin (Gibco, UK) in phosphate buffered saline (PBS) ...
-
bioRxiv - Genetics 2024Quote: ... Proteins were loaded and run on a 4-12% Bis-Tris pre-cast gel or a 3-8% Tris-Acetate pre-cast gel (Invitrogen) and were electrophoretically transferred to a PVDF membrane (Millipore) ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Genetics 2020Quote: ... 25 μL of media containing STS and CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at final treatment concentrations of 1 μM and 2.5 μM ...
-
bioRxiv - Neuroscience 2022Quote: ... The electrodes were labelled with DiIC18(7) (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindotricarbocyanine Iodide) (DiR) (Invitrogen) to enable post-mortem reconstruction of the electrode tracks in histological sections.
-
bioRxiv - Immunology 2022Quote: ... Alexa Fluor 488 and caspase-3/7 activity detection dyes were purchased from Thermo Fisher, and Viobility™ 405/452 Fixable Dye from Miltenyi Biotec.
-
bioRxiv - Microbiology 2023Quote: ... Apoptosis assays were perfomed using CellEvent Caspase 3/7 Green Detection Reagent (Thermo Fisher Scientific) and Live/Dead eFluor 660 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were stained with CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and analyzed on a ViiA 7 or QuantStudio 3 Real Time PCR systems (Applied Biosystems). Viral copy numbers were calculated and normalized to tissue weight by dividing copy number by milligrams of organ weight.
-
bioRxiv - Bioengineering 2024Quote: ... live organoids were perfused with the Caspase-3/7 Green Cytometry Assay Kit (ThermoFisher Scientific) and propidium iodide (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Neuroscience 2024Quote: ... 1∼5 mM in the Fluo-4(F14201, Invitrogen) form of Powder ...
-
bioRxiv - Neuroscience 2021Quote: ... cryoprotected at 4°C in 30% sucrose (Thermo Fisher Scientific) for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse HMB45 (1:20; 4°C overnight; Life Technologies, 081050). Afterwards ...
-
bioRxiv - Systems Biology 2020Quote: ... overnight at 4°C and then homogenized in TRIzol (Invitrogen) using 4 x 2.8 mm ceramic beads (MO BIO Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... coated streptavidin beads overnight rotating at 4°C (Exobeads, Invitrogen). Beads were then collected using a magnet and washed 3 times with PBS supplemented with 0.1% BSA ...
-
bioRxiv - Neuroscience 2022Quote: Cells were washed three times with 4°C PBS (Gibco) containing 1 mM EGTA and 1 mM EDTA then lysed in RIPA buffer (100 mM NaCl ...
-
bioRxiv - Neuroscience 2022Quote: ... for 2 days at 4 °C (Invitrogen, both 1:500). After washing ...
-
bioRxiv - Neuroscience 2023Quote: ... and processed at 4°C with NeuroTrace (1:500, Invitrogen) in PBS containing 0.3% Triton-X ...
-
bioRxiv - Immunology 2024Quote: ... and hold at 4 °C (Applied Biosystems ProFlex PCR System). The primer sequences can be found in Table 1.
-
bioRxiv - Bioengineering 2024Quote: ... Patterns were stored at 4°C in 1X PBS (Gibco). This technique produces patterns that are stable for one month prior to cell seeding and two weeks in culture ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and processed at 4°C with NeuroTrace (1:500, Invitrogen) in PBS containing 0.3% Triton-X ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... at 95 °C for 5-10 min and loaded on a gradient 4-12% NuPAGE Bis-Tris gels (Invitrogen). After electrophoresis at 200 V ...
-
bioRxiv - Bioengineering 2020Quote: ... The marrow was flushed out of the bones via 2 - 5 mL 4 °C DPBS (Dulbecco’s Phosphate-Buffered Saline; Cat. No. 21-031-CV; Gibco) injection ...
-
bioRxiv - Cell Biology 2022Quote: ... Remnant villi were removed by shaking tissue pieces at 4°C in an initial 5 minute incubation PBS with 10 mM RNase-free EDTA pH 8.0 (Invitrogen). Crypts were collected and filtered through 70 µm cell strainers in subsequent fractions ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibody O/N at 4°C (5% FBS, 0.5% Tx, 0.2% gelatine in PBS; GFP (1:500, ThermoFisher Scientific). Slices were then repeatedly washed with PBS-0.5% Tx ...
-
bioRxiv - Biochemistry 2022Quote: ... and heated at 95°C for 5 min before loading onto a NuPAGE Bis-Tris 4-12% gel (Invitrogen). Immunoblotting was performed using a Mini Trans-Blot cell (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... denaturated 5 min at 95°C and finally loaded on NuPAGE 4-12% Bis-Tris protein gels (Life Technologies) and electro-transferred onto nitrocellulose membranes ...
-
bioRxiv - Genomics 2021Quote: ... centrifuged at 500xg for 5 minutes at 4°C using a swinging bucket rotor (Sorvall Legend RT, Thermo Fisher), and then pellets were washed with an additional 1 mL cold lysis buffer and incubated on ice for an additional 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... which were boiled for 5 min at 95°C and then separated on 4-12% polyacrylamide gradient gels (Invitrogen). After blotting ...