Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... The relative expression of each target was calculated using the relative quantification method (2-ΔΔCT) with RNA18S (5’-TGTGGTGTTGAGGAAA-GCAG-3’ and 3’-TCCAGACCATTGGCTAGGAC-5’; Invitrogen) as internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (95°C for 3 seconds, 60°C for 30 seconds) on a QuantStudio 3 (Applied Biosystems, MA).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and incubated overnight at 4°C with primary antibody solution: Antibody in IF buffer containing 3% Saponin (Fisher Scientific, Cat. No. 55-825-5100GM). Antibodies used were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-\56-FAM\ CCT ACC TTA ACC TCC C-3’ with Minor Groove Binder (MGB; ThermoFisher Scientific). PCR was performed using 10X Master Mix to yield a final volume of 25 µl and final working concentrations of 16.6mM (NH4)2SO4 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5′-CCCAAGACTTCCACCTACATTC -3′ (Tm = 62°C) and subsequently subcloned into PCR II-TOPO-TA cloning vector (Invitrogen). Riboprobes were generated with a BIOT-NTP labeling kit (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... for 3 hours at 37 °C before transforming 5 μL into TOP 10 chemically-competent bacteria (Invitrogen). Mutations were confirmed in selected clones by DNA sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Spike-in controls cel-miR-39-3p (C. elegans sequence: 5’-UCACCGGGUGUAAAUCAGCUUG-3’, Invitrogen, Waltham, MA, USA) and cel-miR-54-3p (C ...
-
bioRxiv - Immunology 2021Quote: ... Samples from Biosafety Level 3 were inactivated for 2 hours at RT with 4% paraformaldehyde (ThermoFisher Scientific) after extracellular and intracellular staining.
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged after reaching 70-85% confluency (every 3-4 days) using Accutase (Gibco #A11105-01) to disperse into single cells and replated in mTeSR1 supplemented with 1% P/S containing 10 µM Rock Inhibitor (Y-27632 ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described.13 Cells were passaged every 3-4 days using Collagenase Type IV (Life Technologies). Expression of pluripotency markers was analyzed by flow cytometry using SOX2 (Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... N-(3-triethylammoniumpropyl)-4-(p-diethylaminophenyl-hexatrienyl) pyridinium dibromide (FM4-64) (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (9) ...
-
bioRxiv - Cell Biology 2023Quote: ... hESCs were passaged at 70-80% confluency every 3-4 days into Geltrex coated dishes (Life Technologies) using gentle cell dissociation reagent (STEMCELL-Technologies) ...
-
bioRxiv - Genomics 2023Quote: ... and CRISPRmap library plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000001) in lentiviral packaging medium (Opti-MEM (Thermo Fisher Scientific 31-985-070 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by NuPAGE 3-8% or 4-12 % Tris-Acetate Midi Gel (Invitrogen, Cat# WG1402BX10) and transferred to nitrocellulose membranes (Fisher ...
-
bioRxiv - Immunology 2023Quote: ... for 3-4 days to OD 0.6 in tryptone soya broth (Oxoid) supplemented with 10% FCS (Gibco) and the antibiotics above ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 hours for E14.5 and 4 hours for E18.5 tissues and then blocked in CAS Block (ThermoFisher) for at least two hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were subcultured every 3-4 days by washing with Dulbecco’s phosphate buffered saline (DPBS, GibcoTM, ThermoFisher) and detached with trypsin (GibcoTM ...
-
bioRxiv - Immunology 2022Quote: ... Epithelium was then collected by centrifugation (3 min, 300g, 4 ºC) and digested by TrypLE express (Gibco) for 1 minute at 37ºC and vortexed ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt (DiD, catalog number: D7757) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... ells were stained with 3 mM Fluo-4-AM for 25 minutes in DMEM (Thermo Fisher, 10567014). After two washes with DPBS ...
-
bioRxiv - Immunology 2024Quote: ... and pMD2.G at a ratio of 4:3:1 using Lipofectamine 3000 kit (Thermo Fisher Scientific). 2D3 Jurkat 76.7 cells expressing human CD8+ and NFAT-GFP (Morimoto et al ...
-
bioRxiv - Biophysics 2024Quote: The annealed RNA structure (4 fmol) was mixed with 3 µl of MyOne T1 streptavidin beads (Invitrogen) in Hybridization Buffer (10% PEG8000 ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...