Labshake search
Citations for Thermo Fisher :
7501 - 7550 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... the QuantStudio™ 3 Real-Time PCR System (ThermoFisher, cat# A28137) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 and 9 μg respectively using Lipofectamine 2000 (Thermo Fisher, 11668027). Infectious supernatant was collected at 48 and 72 hours after transfection and filtered to remove cell debris ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Genetics 2021Quote: ... and qPCR was performed in a QuantStudio 3 instrument (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DMSO (3% v/v final conc.) and dNTPs (Thermo Scientific, #R0191). Twenty-nine PCR cycles were performed using the manufacturer’s protocol (annealing temperature ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Electrodes were labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine; Invitrogen) for postmortem reconstruction of their tracks in histologic sections ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3’ adenine overhangs were added (AmpliTaq DNA Polymerase Kit, Life Technologies). PCR amplification was performed via Kapa Hifi DNA Polymerase (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA concentration was measured using a Qubit 3 fluorometer (ThermoFisher Scientific) with the dsDNA BR (Broad Range ...
-
bioRxiv - Developmental Biology 2020Quote: ... plus 3 μL lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, cat. #13778075), following manufacturer protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using QuantStudio 3 (Thermo Fisher, U.S.) following the MIQE guideline(Bustin et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Biophysics 2022Quote: ... 3 mL of CO2-independent α-MEM culture medium (Thermo Fisher) was pipetted on top of the samples ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
bioRxiv - Neuroscience 2021Quote: ... in a Quant Studio 3 Real-Time PCR system (Thermo Fisher). Crossing threshold (Ct ...
-
bioRxiv - Neuroscience 2021Quote: ... by a wet-transfer apparatus (Vep-3, Thermo Fisher Scientific, U.S.A.). The membrane was washed by TTBS (0.9% NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 ml of dissection medium containing 10X trypsin (15400-054, Invitrogen) at 37°C for 15 minutes was added ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3%-8% NuPAGE Tris-Acetate Protein Gels (Thermo Fisher Scientific) for high molecular weight proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... following a 3-hours treatment with 100 ng/mL colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Genomics 2020Quote: ... DNA concentration and purity were measured with a Qubit 3 (Invitrogen) and Nanodrop ND-1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: mIMCD-3 cellls were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) and HEK293 cells with polyethylenimine (PEI ...
-
bioRxiv - Genetics 2021Quote: qRT-PCR was performed using the QuantStudioTM 3 System (Applied Biosystems) set to standard curve mode in 96-well 0.1-mL block ...
-
bioRxiv - Genetics 2021Quote: Total RNA concentrations were measured on a Qubit 3 (ThermoFisher Scientific) using a Qubit RNA BR Assay Kit (Q10211 ...
-
bioRxiv - Systems Biology 2021Quote: ... Cell viability was determined by TO-PRO-3 (Thermo Fisher Scientific) staining.
-
bioRxiv - Genomics 2021Quote: ... cells were washed 3 times with DPBS (Life Technologies 14190-250) then cultured in complete FluoroBrite DMEM media.
-
bioRxiv - Plant Biology 2020Quote: ... leaf discs were incubated in DiBAC4(3) (10 μM, Invitrogen B438) for 30 min and we used the excitation line at 488 nm and recovered fluorescence signal between 505 and 560 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... QPCRs were performed in the Quantstudio 3 apparatus (Thermo Fisher Scientific) with GoTaq qPCR master mix 2X with SYBR Green (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
Cell Ecosystem and Signaling Pathways of Primary and Metastatic Pediatric Posterior Fossa EpendymomabioRxiv - Cancer Biology 2020Quote: ... cDNA concentration was measured with a Qubit 3 Fluorometer (Life Technologies). We used 10 ng of cDNA for each RT-qPCR reaction and KiCqStart SYBR Green primer pairs for GAPDH ...
-
bioRxiv - Microbiology 2020Quote: ... on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... The assays were performed on a QuantStudio 3 instrument (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Bioengineering 2021Quote: ... and a QuantStudio™ 3 Real-Time PCR System (ThermoFisher Scientific).
-
bioRxiv - Biophysics 2021Quote: ... Cells were counted using a Countess 3 FL cell counter (Invitrogen), pelleted by centrifugation for 2 min at 200 g ...
-
bioRxiv - Neuroscience 2020Quote: ... Gradient gels (3% - 8% Tris-acetate protein gels, Thermo Fisher Scientific) were loaded with the lysates and run for 55 min at 150 V in Tris-tricine buffer (50 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked in 3% bovine serum albumin in PBS (Fisher Scientific). Cells were stained with the indicated primary antibodies for overnight in 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Constructs were transfected into PC-3 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommended procedures and GFP containing cells were sorted by flow cytometry ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplicons were analyzed in 3% agarose gels stained with SYBRsafe (Thermofisher).
-
bioRxiv - Cell Biology 2020Quote: ... and washed 3 times with 1x PBS (Fisher Scientific, BP399-1).
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the QuantStudio 3 (Thermo Fisher Scientific) platform and the cycling conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... following the manufacturer instructions in a QuantStudio 3 equipment (ThermoFisher Scientific). Primers for the normalizing gene rpsJ (F_rpsJ 5’ TGAAACGGCTAAGCGTTCTG 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000 dilution, Invitrogen). Secondary antibodies against rabbit and mouse IgG conjugated to IRDye 680LT or IRDye 800CW were obtained from Li-Cor (1:10,000 dilution) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 μl UltraPure Water (Thermo Fisher Scientific, Waltham, MA, USA). Each amplification was performed in technical triplicate ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...