Labshake search
Citations for Thermo Fisher :
7451 - 7500 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Human embryonic stem cells were maintained in StemFlex (Thermo Fisher Scientific, A3349401). Unless specified otherwise ...
-
bioRxiv - Bioengineering 2024Quote: ... Intracellular staining: anti-human MX1 CoraLite® Plus 488 (Invitrogen, 1:20).
-
bioRxiv - Microbiology 2024Quote: ... Lentiviral constructs expressing human RSKs were constructed using the Gateway technology (Invitrogen) from donor plasmids ...
-
bioRxiv - Bioengineering 2024Quote: ... and mouse-anti-human CD105 (clone SN6) were purchased from Thermo Fisher Scientific (Massachusetts ...
-
bioRxiv - Biochemistry 2024Quote: ... Amplified cDNA was hybridized on Human Clariom S arrays (Thermo Fisher Scientific). Staining and scanning (GeneChip Scanner 3000 7G ...
-
bioRxiv - Biochemistry 2024Quote: Human DNA-PKcs was detected with antibody 18-2 (Invitrogen MA5-13238). Recombinant human KU70 was detected via an N-terminal FLAG-tag with antibody M2 (Sigma F1804) ...
-
bioRxiv - Cancer Biology 2024Quote: ... ELISA was performed using IL-1 beta Human ELISA Kit (Invitrogen #KHC0011) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... Human serum and standard samples were diluted x4 with FBS (Gibco, #10270106) and incubated for two hours at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: Anti-human CD90 conjugated to FITC or APC (11-0909-42, ThermoFisher) were used for the staining of the MSCs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and human embryonic kidney 293T cells (ATCC) were cultured in DMEM (Gibco) and authenticated using the short tandem repeat profiling (ATCC) ...
-
bioRxiv - Cell Biology 2024Quote: ... They were then activated with Dynabeads Human T-Activator CD3/CD28 (Gibco) at a 1:1 bead-to-cell ratio.
-
bioRxiv - Cell Biology 2024Quote: MCF10A cells (human breast epithelial) were cultured in DMEM/F12 (11320074; Gibco) containing 5% horse serum (16050-122 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Non-malignant human PIG3V melanocytes62 were maintained in Media 254 (ThermoFisher Scientific) containing 1% human melanocyte growth supplement (HMGS) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Goat anti-human Alexa 488 secondary antibody was procured from Thermo Fisher Scientific (A11013 ...
-
bioRxiv - Developmental Biology 2024Quote: ... human or mouse embryonic stem cells were dissociated with Accutase (Gibco, A1110501), resuspended in EB Formation medium (StemCell Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: 3′-RACE was used to determine the length of the mRNA 3′UTRs using the 3′RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Yeast total RNA used for steady-state and half-life northern blots was used to generate cDNA using SuperScript™II RT (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2024Quote: SYTL5 was amplified from WT U2OS cDNA (5’-ATGTCTAAGAACTCAGAGTTCATC-3’ and 5’-TTAGAGCCTACATTTTCCCATG-3’) and cloned into Zero Blunt TOPO vector using Zero Blunt™ TOPO™ PCR Cloning Kit (Thermo Fisher Scientific #450245) according to the manufactureŕs instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Beads were then washed 3 times for 3 min each with lysis buffer and RNA isolated after addition of 1 ml TRIZOL (Life Technologies cat. no. 15596-018). RNA isolated from 10% lysate was used as input ...
-
bioRxiv - Microbiology 2020Quote: ... Template preparation was performed by the Ion PGM Hi-Q View kit on the Ion OneTouch™ 2 System (Life Technologies, Grand Island, NY, United States) and sequenced using the Ion PGM Hi-Q View sequencing kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... in HepG2 medium (Advanced MEM minus L-Glutamine [Gibco] + 10% [v/v] HI-FBS [Gibco] + 1% [v/v] penicillin-streptomycin + 2 mM Glutamax [Gibco] and 0.1% [v/v] amphotericin B). Once the HepG2 or HC-04 cells were grown to the desired concentration ...
-
bioRxiv - Cell Biology 2020Quote: The breast cancer cell line MDA-MB-468 was cultured at 37°C and 5% CO2 in RPMI medium supplemented with 10% (v/v) fetal calf serum (FCS) and Antibiotic-Antimycotic (Thermo Fisher Scientific, Schwerte, Germany). The keratinocyte cell line HaCaT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Japan) and was measured at an optical density (OD) of 450 nm with a Multiskan FC microplate photometer (Thermo Fisher Scientific, Waltham, MA, USA). For the cell proliferation assay ...
-
bioRxiv - Immunology 2020Quote: Analysis of IgG Fc-glycosylation was performed with nanoLC reverse phase (RP)-electrospray (ESI)-MS on an Ultimate 3000 RSLCnano system (Dionex/Thermo Scientific, Breda, The Netherlands) coupled to an amaZon speed ion trap MS (Bruker Daltonics ...
-
bioRxiv - Immunology 2020Quote: ... Briefly, TILs were cultured in RPMI 1640 culture medium (SERO-Med GmbH, Wien) supplemented with 10% FCS HyClone (Gibco Laboratories, Grand Island, NY, USA) and stimulated for 5 h using the Leukocyte Activation Cocktail ...
-
bioRxiv - Biochemistry 2022Quote: ... Prostate cancer cell lines were cultured in RPMI medium supplemented with 2 mM L-glutamine and 10% heat-inactivated FCS (ThermoFisher Scientific, Melbourne, VIC, Australia). Cell media was changed every three days and cells were passaged regularly at ∼80-90% confluency by trypsinization ...
-
bioRxiv - Cell Biology 2022Quote: ... the confocal volume was determined by performing FCS using a dye with known diffusion coefficient and concentration (Alexa Fluor 488 NHS ester; Thermo Fisher Scientific for mEGFP). To convert fluorescence intensity to the concentration ...
-
bioRxiv - Microbiology 2022Quote: ... Staining for surface markers was performed by incubating the cells in single cell suspension with anti-mouse CD16/CD32 mouse Fc block (Thermo Fisher Scientific, RRID: AB_467135) and 10% rat-IgG in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Media was removed and cells were subsequently incubated in 100µg/ml pHrhodo Green Dextran-containing complete DMEM media (10% FCS (Fisher Scientific, Cat#: 10-438-026), 1% P/S (Gibco ...
-
bioRxiv - Microbiology 2023Quote: The growth burden imposed by lateral flagella was determined in an automated growth experiment in a MultiskanTM FC microplate photometer (Thermo Scientific, software SkanIt 4.1). The wells of a 96-well microplate were filled with 200 μl of either MB alone (blank wells and border wells ...
-
bioRxiv - Immunology 2023Quote: ... The fragment antigen-binding (Fab) part was separated from undigested IgG and the crystallizable fragment (Fc) using an Immobilized Protein A column (Thermo Fisher Scientific, No. 20356). The flow through containing the Fab was concentrated through 10 kDa Amicon centrifugal filter units (EMD Millipore ...
-
Variation of wine preference amongst consumers is influenced by the composition of salivary proteinsbioRxiv - Biochemistry 2023Quote: ... to a microplate for the absorbance measurement at 765 nm with a Varioskan Flash plate reader (Multiskan FC Microplate Photometer, Thermo Scientific, Waltham, MA, USA). A calibration curve of the standard compound gallic acid with a linearity range from 50 mg/L to 800 mg/L was constructed ...
-
bioRxiv - Immunology 2023Quote: Mouse peripheral blood was processed to remove RBC via lysis prior to Fc blocking and then stained with antibodies against surface markers including biotin-CD93 (Invitrogen, cat # 13-5892-85), BV605-CD19 (BD ...
-
bioRxiv - Immunology 2023Quote: ... the cultured B cells were stained with Fc block followed by fixable viability dye eFluor 780 and FITC BAFF-R monoclonal antibody (Invitrogen; cat #11-5943-81) and analyzed on a LSRFortessa X-20 flow cytometer (BD).
-
bioRxiv - Neuroscience 2024Quote: ... Media was removed and cells were subsequently incubated in 100µg/ml pHrhodo Green Dextran-containing complete DMEM media (10% FCS (Fisher Scientific, Cat#: 10-438-026), 1% P/S (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... All plates were incubated at 28 °C for 96 hours and absorbance was measured using Microplate reader Multiskan FC photometer (Thermo Fisher Scientific, MA, USA) at 590 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... were loaded onto a 96-well plate and absorbance was measured at 405 nm using a Multiskan™ FC Microplate Photometer (Thermo Fisher Scientific, USA). For analysis ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Plant Biology 2020Quote: ... and a precise concentration measurement with the Qubit 3 (Invitrogen, USA). The integrity of the RNA was confirmed via agarose gel electrophoresis.
-
bioRxiv - Biophysics 2021Quote: ... and 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine (DiD) were from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Quantitative PCR reactions were run on a QuantStudio 3 (Applied Biosystems) using the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... in 100 μl of 3% bovine serum albumin (BSA, Fisher Scientific) diluted in PBS ...