Labshake search
Citations for Thermo Fisher :
7301 - 7350 of 10000+ citations for Mouse Receptor Interacting Serine threonine Protein Kinase 1 RIPK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: The Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, San Jose, CA, USA) was used according to manufacturer’s protocol to determine protein content post extraction ...
-
bioRxiv - Cell Biology 2024Quote: ... Click-iT™ HPG Alexa Fluor™ 594 Protein Synthesis Assay Kit (Invitrogen C10429) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein amounts were quantified with a Pierce BCA kit (Thermo Fisher Scientific, Somerset, NJ), mixed with 6x Laemmli buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... labeling was performed using the Alexa FluorTM 488 Microscale Protein Labeling Kit (#A30006, Invitrogen) according to manufactureŕs instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Pierce bicinchoninic acid (BCA) protein assay kit was purchased from Thermo Scientific (Rockford, IL). NuPAGE Bis-Tris precast gels were purchased from Life Technologies (Carlsbad ...
-
bioRxiv - Molecular Biology 2024Quote: ... Visualization of the protein bands was performed with Pierce Silver Stain Kit (Thermo Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: Cells and mouse tissues were lysed in M-PER or T-PER Tissue Protein Extraction Reagent (Thermo Fisher Scientific) containing additional 1X PhosStop (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were extracted from cultured cells or mouse tissue (skeletal muscle, lungs) using 1X DPBS (Thermo Fisher Scientific 14190144) supplemented with 0.5% IGEPAL CA-630 ...
-
bioRxiv - Biochemistry 2020Quote: ... Binding of the full-length S protein was detected by mouse anti-His IgG (Invitrogen MA121315, 2 μg/ml) and Alexa Fluor-488-labelled goat anti-mouse IgG (Invitrogen A11001 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mice were bled and total IgG (mouse and human) was pulled down using protein A beads (ThermoFisher, Catalog # 20333). An in–house sandwich ELISA was used to measure human IgG (control IgG or MS-Hu6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Acquired MS/MS spectra were searched against the mouse Uniprot protein database using SEQUEST and the Percolator validator algorithms in Proteome Discoverer 2.2 (ThermoFisher). The precursor ion tolerance was set at 10 ppm and the fragment ions tolerance at 0.02 Da ...
-
bioRxiv - Molecular Biology 2019Quote: ... mouse monoclonal or anti-GFP rabbit polyclonal (ab290) antibody was incubated with Protein-G/A magnetic beads (Dynabeads, Invitrogen) in PBST for 2hrs at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysates from macrophages and whole mouse lungs were prepared with RIPA lysis buffer (ThermoFisher Scientific, Waltham, MA, USA) containing protease inhibitor cocktail (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Protein lysates from macrophages and whole mouse lungs were prepared with RIPA lysis buffer (ThermoFisher Scientific, Waltham, MA, USA) containing protease inhibitor cocktail (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... For protein detection secondary anti-mouse or anti-rabbit antibodies conjugated either to Alexa Fluor 488 and 555 (Invitrogen) for immunofluorescence or to horseradish peroxidase (HRP ...
-
bioRxiv - Immunology 2024Quote: Protein lysates from macrophages and whole mouse lungs were prepared with RIPA lysis buffer (ThermoFisher Scientific, Waltham, MA, USA) containing protease inhibitor cocktail (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and the mouse monoclonal antibody (17TF2-1H4) specific for the bacterial maltose-binding protein (anti-MBP, #MA3045 Fisher Scientific) were purified as described,[34] with minor modifications ...
-
Undruggable oncoproteins cMyc and NMyc bind to mediator of transcription with superior high affinitybioRxiv - Biochemistry 2024Quote: ... The immuno-detection of proteins was carried out using mouse anti-HA monoclonal antibody (2-2.2.14, #26183, ThermoFisher Sci) and secondary anti-mouse IgG antibodies conjugated with horseradish peroxidase (#A9044 ...
-
bioRxiv - Immunology 2023Quote: ... Protein detection was performed by incubation with a 6x-His Tag mouse monoclonal antibody (clone: HIS.H8; Thermo Fisher Scientific), followed by a secondary goat-anti-mouse HRP antibody (clone NA9310 N ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins transferred to nitrocellulose membranes were blocked and blotted using primary antibodies against: 6xHis (mouse monoclonal, Invitrogen MA1-135); 20S α4 PSMA7 (mouse monoclonal anti-human ...
-
bioRxiv - Neuroscience 2023Quote: Whole mouse brains were homogenized with a Dounce tissue grinder in neuronal protein extraction reagent (N-PER) (Thermo Scientific) containing protease/phosphatase inhibitors (Cell Signaling ...
-
bioRxiv - Microbiology 2022Quote: ... Luminex kits that were used are as follows a custom mouse IFN kit (IFN alpha, IFN beta, IL-28, Invitrogen), mouse cytokine 23-plex (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... overnight followed by secondary (anti-rabbit ThermoFisher #31466 1:10000, anti-mouse ThermoFisher #31431 1:10000) for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... Goat anti-mouse IgG Alexa Fluor 488 (1:500 dilution in 1% BSA in PBS; Invitrogen) was used as the secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 1 h with secondary antibodies (anti-Mouse IgG 488, 1:1000 Invitrogen, #A11029 ...
-
bioRxiv - Microbiology 2020Quote: ... followed by staining for 1 h with anti-mouse AF647 (1:1000; A-28181, Molecular Probes). The membrane was washed 3 times for 5 minutes with PBS containing 0.05% Tween 20 with rocking between each step ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were incubated 1 hr with secondary antibody (Alexa 647 donkey anti-mouse, Invitrogen, 1:500) in the above buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was then bound to Early Endosome Antigen 1 mouse antibody (1:250, Fisher Scientific) and anti-mouse IgG magnetic microbeads (Miltenyi Biotech ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were stained with mouse-anti-human-ZO-1 1:500 (Thermo Fisher Scientific, 33-9100) or guinea pig-anti-zebrafish-VE-cadherin 1:500 (Paatero ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-H3K27me3 (1:1000) and mouse anti-FLAG (1:200; Thermo Fisher Scientific #MA1-91878). Cells were labeled with Alexa Fluor 568-conjugated goat anti-rabbit IgG (Invitrogen #A-11036) ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 1 hour incubation at room temperature with goat anti-mouse AF488 (ThermoFisher, 1:400), goat anti-rabbit AF647 (ThermoFisher ...
-
bioRxiv - Genetics 2020Quote: ... Antibodies were NKX2-5 (mouse, R&D, 1:500) and β -actin (rabbit, Invitrogen, 1:1000). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:200, RRID:AB_11042577), anti-GFP (chicken, Abcam, catalog #ab13970, 1:500, RRID:AB_300798, anti-p73 (mouse, Invitrogen, catalog #MA5-14117 ...
-
bioRxiv - Genetics 2024Quote: ... The following antibodies were used: mouse anti-ZO-1 (1:500, Thermofisher Cat. No. 33-9100), rabbit anti-Glutamine synthetase (GS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were then stained overnight with primary antibody mouse anti-ZO-1 (1:250; Invitrogen #339100) in blocking buffer at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse or anti-goat Alex Fluor 594 (1:600 to 1:1000, Thermo Fisher Scientific), and anti-rabbit Alex Fluor 546 (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-P1 (1:100, Istvan Ando)64 and rabbit anti-GFP(1:300, A11122, Invitrogen) rabbit anti-p-ASK1 (Thr845 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by 1 h secondary labeling with donkey α-mouse Alexafluor488 (1:500)(Invitrogen, cat: A21202) at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... stained with primary antibody (rabbit anti-iba-1, 1:1000, Wako, #019- 19741; mouse anti-NeuN, 1:1000, Abcam, #ab104224; Hoechst, 1:1000, Thermo Fisher, H1399) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... The supernatants of human CD19 CAR T cells or human TCR transfected CD8+ T cells were analyzed by IFNγ Human Uncoated Elisa Kit (Invitrogen, Thermo Fisher Scientific # 88-7316-88). Plates were read on BioRad plate reader at a wavelength 450 nm and subtracted by 595 nm.
-
bioRxiv - Microbiology 2022Quote: ... We extracted the genomic DNA of ELISA-positive cattle using either the magLEAD 12gC or a MagMAX™ CORE Nucleic Acid Purification Kit (Thermo Fisher Scientific Inc., Waltham, USA) with an automated nucleic acid extraction system (KingFisher Duo Prime ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R) (32) were maintained at 37°C in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% serum (HyClone FetalClone II ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2019Quote: ... a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor ...
-
bioRxiv - Immunology 2020Quote: ... pH 7.2) resuspended and incubated for 30 min in FACS buffer supplemented with Fc gamma receptor CD16/CD32 antibodies (ThermoFisher). Cells were then incubated with Alexa fluor 488-conjugated antibodies against F4/80 or rat IgG2a kappa isotype control ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...