Labshake search
Citations for Thermo Fisher :
7151 - 7200 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... For lipid peroxidation cells were stained with either 5 μM BODIPY™ 581/591 C11 (ThermoFisher Scientific) or MitoPerOx (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5% CO2 in DMEM (for HEK293 and HeLa) supplemented with 10% Fetal bovine serum (Invitrogen, Switzerland) and 1% of Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μl of RNase A/T1 mix (2 μg/μl, 5 U/μl, Thermo Scientific, cat#EN0551) was added to 400 μl of the cleared lysate and incubated for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... NECs were harvested using EDTA-PBS for 5 min and resuspended in Neurobasal medium (Thermo Fisher Scientific) consisting of 1% N2 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... and 50 μL of the 3,3′-dipropylthiadicarbocyanine iodide (DiSC3(5)) dye (Thermo Fisher Scientific, Waltham, MA, USA), prepared separately in 0.05×PDB at a concentration of 6 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were stained with 5 µM SYTO9 (live; green) and 10 µM propidium iodide (dead; red) (ThermoFisher) and incubated for 15 min at room temperature in the dark ...
-
bioRxiv - Systems Biology 2022Quote: ... ‘mitoSOX red’ to stain intracellular superoxide (at 5 µM final concentration, Thermo Fisher scientific Cat. No. M36008) or ‘cellROX orange’ to stain intracellular ROS (at 5 µM final concentration ...
-
bioRxiv - Immunology 2022Quote: ... blocked for 2 hours at room temperature with 1X PBS supplemented with 5% Fetal Calf Serum (Invitrogen) and 0.25% Tween-20 (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... for 3–5 s and then washed thoroughly in phosphate-buffered saline (PBS) (pH 7.4, Gibco, USA). Single zona pellucida-free embryos were carefully pipetted and placed into individual tubes containing 2 μL PBS ...
-
bioRxiv - Immunology 2022Quote: ... 5 pmol of siRNA or scrambled negative control was mixed with lipofectamine RNAiMAX Reagent (Thermo fisher Scientific) to create a 1 pmol siRNA solution ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 were labeled with 10 μM Cell Proliferation Dye eFluor® 670 (Invitrogen) and then stimulated with virus ...
-
bioRxiv - Cancer Biology 2022Quote: ... Medium was supplemented with 5% (Ishikawa cells) or 10% (rest of cells) foetal bovine serum (FBS, Gibco) and 1% Penicillin/Streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 mM probenecid (Life-Technologies: catalog # P36400) and 5 µM Fluo-3 (Life Technologies; catalog # F-14218). Cells were incubated at 37°C for 30 minutes before being centrifuged and resuspended in modified L-15 media containing 2% FBS and 2.5 mM probenecid ...
-
bioRxiv - Cell Biology 2022Quote: ... or 5 nM Silencer select siRNAs were transfected using Lipofectamine RNAi max transfection reagent (Thermo Fisher Scientific) at the same time as cell seeding ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-mM primer mix and 5-μl SYBR green Select master mix CFX (Thermo Fisher, Cat. #4472942). Every reaction was done in triplicate and for every sample ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples was incubated with DAPI for 5 minutes and mounted (ProLong™ Diamond Antifade Mountant, Life Technologies).
-
bioRxiv - Biochemistry 2022Quote: ... or EGFP-FMRP and mCherry-DHX9-HD were grown at 37 °C (5% CO2) in DMEM (Gibco) supplemented with 10% FBS (Benchmark) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The thermal cycling and data collection were performed on Quantstudio 5 Real-Time PCR instrument (Thermo Fisher), using the thermal cycling protocol 2 min at 50 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The protein-antibody-sepharose mixture was then washed 5 times in Pierce IP lysis buffer (ThermoFisher Scientific) and resuspended in 2X Laemmli sample buffer (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5 kb PCR fragment was coupled to magnetic streptavidin beads (Dyna-beads M-270 Streptavidin, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Fixed HUVEC were blocked for 1h at RT in blocking solution (5% FBS, 2X antibiotic-antimycotic (Gibco), 0.1% sodium azide (s2002-100G ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 μl serum samples collected at E19 were loaded into Bis-Tris gels (NuPAGE Novex, Life technologies) and transferred to nitrocellulose membranes (Invitrogen) ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were cultured at 37 °C with 5% CO2 in RPMI 1640 with L-glutamine (Life Technologies), supplemented with 10% fetal bovine serum (Omega) ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’ overhang was repaired using a biotinylated residue (0.4 mM biotin-14-Datp (INVITROGEN, America). The resulting blunt-end fragments were ligated in situ (10X NEB T4 DNA ligase buffer (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... PKC-specific custom siRNA targeting to endogenous human PKCα (5’-CAGAAGAACTGTATGCAAT-3’) was purchased from Ambien (ThermoFisher). To perform knockdowns ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% fetal bovine serum (Atlanta biologics, cat # S11550) and 1% penicillin/streptomycin (Life technologies, cat# 15070) at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... RNA (5 ng/µL) was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). 1 µL of cDNA was used as template in a 10 µL qRT-PCR reaction performed with Power SYBR reagent (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Embedded samples were sectioned into 5 µm slices using a MICRO HM355 (Thermo Fisher Scientific, Walldorf, Germany) instrument ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using 1 μL of 5 μM Powerup SYBR green PCR Master Mix (Applied Biosystems), 2 μL of dH2O and 2 μL of cDNA sample in a 10 μL reaction ...
-
bioRxiv - Plant Biology 2019Quote: ... and 5 μL of Power SYBR® green RNA-to-CT™ 1-step kit (Applied Biosystems) that has limits of detection as low as 2 copies of the target gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor cells were stained with CellTracker™ Green CMFDA (5-chloromethylfluorescein diacetate) Dye (1 μM, #C7025, Invitrogen) and seeded (5×104/well ...
-
bioRxiv - Physiology 2019Quote: ... RT-qPCR was performed on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Carlsbad, California), with Fast SYBR Green master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: ... The sample was loaded onto the trapping column (Thermo Scientific, PepMap100, C18, 300 μm X 5 mm), using partial loop injection ...
-
bioRxiv - Biochemistry 2019Quote: ... The sample was loaded onto the trapping column (Thermo Scientific, PepMap100, C18, 300 μm x 5 mm), using partial loop injection ...
-
bioRxiv - Genomics 2020Quote: ... The resulting hairpin molecules were bound on 5 μg of Dynabeads™ MyOne™ Streptavidin T1 (Invitrogen) in PB for 60 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and heated for 5-10 min at 95°C in LDS-sample loading buffer (Life Technologies, NP0008) containing 50 mM dithiothreitol (Amersham Biosciences ...
-
bioRxiv - Systems Biology 2020Quote: ... the peptides were dissolved with 0.1% (v/v) TFA and 5% (v/v) acetonitrile (Thermo Fisher Scientific) and subjected to desalting using StageTips with SDB-XC Empore disk membranes (SDB-XC StageTip ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg of total RNA was reverse transcribed using oligo dT and SuperScript Reverse Transcriptase III (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... containing a 5′-CACC-3′ sequence required for directional TOPO cloning in pENTR/D-TOPO (Invitrogen, USA), and a reverse primer [“Tgd057 R HA stop” 5’-TTACGCGTAGTCCGGGACGTCGTACGGGTACTCGACCTCAATGTTGTATTC-3’] ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was extracted from phenotypic leaf tissue collected 5 days after treatment using Trizol reagent (Invitrogen) following manufacturers protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 μg of PSD-95 antibody was coupled to 1 mg of Dynabeads (Life Technologies, CA, USA) according to the antibody coupling kit protocol (#14311D) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR analyses were performed with 5 µl of cDNA using SYBR© Green fluorophore (Applied Biosystems), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... and applied to a gravity column with 5 mL of HisPur Ni-NTA resin (Thermo Fisher Scientific) prepared in equilibration buffer (40mM Tris [pH 7.4]) ...
-
bioRxiv - Molecular Biology 2020Quote: The newly synthesized RNA in OSC cells was labeled with 5-ethynyl-uridine (EU) (Life Technologies, #E10345) as described (61) ...
-
bioRxiv - Physiology 2021Quote: ... HRP-linked anti-rabbit IgG (1:10000 in 5% BSA for WB. NP40 (Thermal Fisher Scientific, 28324), Triton™ X-100 (T-9284) ...
-
bioRxiv - Neuroscience 2020Quote: ... and kept on ice until sorting and incubated with 5 μg/ml propidium iodide (PI; Life Technologies).
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated with anti-GFP antibody (5 μg/ml) prebound to Dynabeads Protein A (Invitrogen) for 2h with end-over-end rotation to capture GFP-fused L10a subunit of the 60S ribosome ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragmented chromatin was then pre-cleared with 5 μl of Dynabeads Protein A/Protein G (ThermoFisher) and immunoprecipitated overnight at 4 °C with the pre-prepared antibody-beads complex ...
-
bioRxiv - Plant Biology 2021Quote: ... a standard PCR (RT-PCR) was then performed using DreamTaq DNA polymerase (5 U/μL) (Thermo Scientific). VIGS BAK1 silencing was confirmed as previously described (Chaparro-Garcia et al. ...