Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Genetics 2022Quote: ... and washed 3-4 times with fresh 10% RNA later solution (Thermo Fisher Scientific). After the last wash ...
-
bioRxiv - Zoology 2022Quote: ... The excised tissues were then placed (3-4 pieces) on gelatin (Attachment Factor, ThermoFisher)-coated dish (35 mm ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3-4 μl of samples were applied onto grids using a Vitrobot (Thermo Fisher). Grids were blotted with “595” filter papers (Ted Pella ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were mock transfected with 4 μL of lipofectamine 3000 (ThermoFisher Scientific) in Opti-MEM (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 10% FBS and split every 3-4 days using TrypLE Express (Thermo Scientific). Low-passage ...
-
bioRxiv - Microbiology 2023Quote: ... sonicated via a Sonic Dismembrator 100 (Fisher Scientific, setting 3, 15 s, 4 pulses), and incubated on ice for 1 hr after the addition of 2 μL benzonase (EMD Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The medium was replaced after 3-4 hr with neurobasal medium (Gibco, Cat# 21103049) supplemented with 2% v/v B27 (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with DMEM and fixed with 4% paraformaldehyde (Thermo Fisher) at room temperature (RT ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (Invitrogen, NuPAGE). After transfer to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 4:3:1 using Lipofectamine 3000 kit (Thermo Fisher Scientific). Viral supernatant was filtered ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were passaged every 3-4 days using 0.25% Trypsin-EDTA (Fisher Scientific) incubated at 37°C for 3-5 minutes to detach cells ...
-
bioRxiv - Neuroscience 2024Quote: ... for 3 h at 4°C and then with protein G magnetic beads (ThermoFisher) at 4°C for an additional 2 h to obtain immunoprecipitated RNA fragments ...
-
bioRxiv - Genomics 2024Quote: ... were treated 3-4 times with 50 U of T4 PNK (Thermo Fisher Scientific) and 100 U of λ-exonuclease (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... NIM was exchanged daily for 3:1-DMEM/F12-medium (3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Cell Biology 2021Quote: ... 1–2 mg of VLDL were combined with 100 μL of 3 mg/mL 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine perchlorate (DiD; Invitrogen) in DMSO and then re-isolated by ultracentrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... tRNAGln was 3’ biotin labeled with the Pierce ™ RNA 3’ end biotin labeling kit (Thermo Fisher) according to manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2022Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) and (ii) 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindotricarbocyanine iodide (DiR) were both from Invitrogen. The standard lipids (i ...
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Cell Biology 2022Quote: ... and washed 3 times with fresh ECGM and 3 times with ECGM/Hoechst 33342 (NucBlue™ ThermoFisher). After 10min incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 mM DTT) and homogenized using a Dounce homogenizer followed by DNaseІ treatment (3 U/µl, ThermoFisher) for one hour on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... UM-UC-3 cells were fluorescently labeled using 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI, ThermoFisher, #D3899) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: The brains of P9-11 C57 mice were immersed and fixed for 3 days in cold 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide HCl (EDC, Thermo Fisher Scientific, in 0.1 M PB, pH 7.4) at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... dsRNA complex (2:1 molar ratio) were cross-linked with 30 μg 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific, EDC: protein = 3:1 w/w) in the presence of 66 μg N-hydroxysulphosuccinimide (NHS ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... (3) 65%-95% for 5 min and (4) washout for 15 min) using the EASY-nano LC 1200 system (Thermo Fisher Scientific) with a flow rate of 300 nL/min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of 3-4 months based on previous established methods188 and maintained at 37°C and 5% CO2 in DMEM (ThermoFisher, MA, USA), supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Biochemistry 2024Quote: ... it was centrifuged 3-5x at 1,300 x g (5 min, 4 °C, Heraeus multifuge X3R, Thermo Scientific, rotor F15-8×50cy) until no pellet was visible ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Genetics 2024Quote: ... and BSA (3%) for 4 hours at 4°C after which streptavidin-agarose UltraLink Resin (Thermo Fisher Scientific) for 1 hour at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were split every 2-3 days through 9 minutes incubation with EDTA 50mM pH=7.4 and 3 minutes of 0.25% trypsin (Gibco).
-
bioRxiv - Neuroscience 2021Quote: ... was performed using the Applied Biosystems QuantStudio 3 Real-Time PCR system and analyzed with the QuantStudio 3 Design and Analysis software (v1.5.1,ThermoFisher). Briefly ...