Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: ... The eight rice 14-3-3 genes cloned in the yeast two-hybrid vector pDEST22 (Invitrogen) were used from a previous study (Deb et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Cancer Biology 2022Quote: ... slides were incubated for 24 minutes in a mixture of 3% 3-Aminopropyltriethoxysilane (ACROS Organics, 430941000) and 5% acetic acid in HPLC EtOH ...
-
bioRxiv - Immunology 2020Quote: ... 3 μL RT reaction mix consisting of 3 μL of 50 μM random hexamers (Thermo Fisher), 0.8 μL of 25 mM deoxyribonucleotide triphosphates (dNTPs ...
-
bioRxiv - Immunology 2023Quote: ... To assess active caspase 3 activity the CaspGLOW™ Fluorescein Active Caspase-3 Staining Kit (Invitrogen) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 24 min in a mixture of 3% 3-aminopropyltriethoxysilane (ACROS Organics, 430941000) and 5% acetic acid in HPLC ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... NIM was replaced to 3:1-medium consisting of 3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Neuroscience 2024Quote: Rabbit monoclonal or polyclonal antibodies include those against 14-3-3 (Invitrogen, 51-0700, 1:1000); clathrin heavy chain (Abcam ...
-
bioRxiv - Biophysics 2024Quote: ... cells were stained with DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (DiI, Invitrogen cat # D383) for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Cell Biology 2024Quote: ... and biotinylated at the 3’end with the Pierce RNA 3’end biotinylation kit (Thermo Fisher). Both antisense and sense strands of the DNA sequence were amplified to obtain a DNA template for in-vitro transcription (Supplementary Figure ...
-
bioRxiv - Developmental Biology 2024Quote: 3 dpf larvae were incubated in 3 µM FM™ 1-43 Dye (Thermofisher catalog # T3163) for 2-4 minutes ...
-
bioRxiv - Physiology 2020Quote: ... muscles were stained for 3 minutes with 10μM 4-(4-diethylaminostyrl)-N-methylpyridinium iodide (4-Di-2ASP, Molecular Probes) to allow imaging muscle with an upright epifluorescence microscope (Leica DMR ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 washes of 5X SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... 3 mM MgCl2 (Thermo Fisher AM9530G), 20 mM Tris-HCl pH 7.5 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... TO-PRO-3 (Thermo Fisher Scientific), or Hoechst 33258 in the blocking buffer for 60 min.
-
bioRxiv - Neuroscience 2020Quote: ... 3 µl of Liptoectamine RNAimax (Invitrogen) was diluted in 150 µl RPMI media and mixed with 150 pmol of siRNA in 150 µl RPMI media and left for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 3% fetal bovine serum (Life Technologies) and 1% Penicillin/Streptomycin/L-glutamine (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (3 µg/ml; Invitrogen). Cells were allowed to adhere in humidified tissue culture incubator (5% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and laminin (3 μg/ml; Invitrogen). For axotomy ...
-
bioRxiv - Neuroscience 2021Quote: ... with 3% B27 (Invitrogen, 17504-001) and 1% Glutamax (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Di-3-ANEPPDHQ (D36801 ThermoFisher Scientific): 4.0 mM in pure DMSO diluted 100 times for use ...
-
bioRxiv - Neuroscience 2020Quote: ... TNF-α (BMS607-3, Thermofisher Scientific), C1q (LS-F55223-1 ...
-
bioRxiv - Genetics 2020Quote: ... Sigma)/laminin (3 µg/mL, Life Technologies) - coated plates in hiNPC medium (70% v/v DMEM (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... 3 powder (Oxoid, Thermo Fisher Scientific) was used to prepare MAC agar ...
-
bioRxiv - Neuroscience 2020Quote: ... and TO-PRO-3 (ThermoFisher, T3605) were added together with the secondary antibody.
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... on a QuantStudio 3 (Applied Biosystems). SARS-CoV-2 RNA was quantified using US Centers of Disease Control and Prevention diagnostic N1 assay ...
-
bioRxiv - Cell Biology 2021Quote: ... program #3 for 7 min (ThermoFisher). The membrane was saturated by incubation in PBS (without EDTA ...
-
bioRxiv - Genomics 2020Quote: ... 3 µg of random Primers (Invitrogen), 8 µL of 5× First-Strand Buffer and 10 µL of RNA mix were incubated at 94 °C for 3 min and then at 4 °C for 1 min ...