Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... QuantStudio 3 (Thermo Fisher Scientific, Tokyo, Japan) was used for the assay ...
-
bioRxiv - Immunology 2024Quote: ... On day 3 cells were trypsinized (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and Tris-Acetate gels (Invitrogen, 3-8%). MOPS buffer (Invitrogen Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a QuantStudio 3 system (Applied Biosystems). The qRT-PCR conditions were 55°C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... A QuantStudio 3 RT-PCR thermocycler (Invitrogen) was used to initially cool to 5°C at a rate of 1.6 °C/s ...
-
bioRxiv - Bioengineering 2024Quote: ... fluorescent labeling of nuclei (TOPRO-3, Thermofisher) and F-actin filaments (Alexa Fluor 488 phalloidin ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μΜ nocodazole (Thermo Fisher Scientific, AC358240100), 2.5 or 5 μΜ STLC (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-8% Tris-Acetate gel (ThermoFisher #EA0375BOX) and 1X MES SDS Running buffer (ThermoFisher #NP0002 ...
-
bioRxiv - Developmental Biology 2024Quote: ... FluoZin-3 (20 µM; F24194, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Biochemistry 2024Quote: ... Half of the culture medium was refreshed every 3-4 days with DMEM (Gibco, USA) supplemented with 10% FBS (CellMAX ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) and resolved (~80 μg/lane) in a linear 3-12% acrylamide gradient (Invitrogen). For BN-PAGE ...
-
bioRxiv - Biophysics 2024Quote: ... The Ca2+-sensitive dyes Fluo-4 AM (Dojindo) and Rhod-3 AM (Thermo Fisher Scientific) were employed ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of MVs were incubated with the FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermofisher) at 2 µg/mL in a final volume of 100 µL in a 96-well black plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2024Quote: ... isolated cerebral microvessels (5 animals per group) or hippocampus (3-5 animals per group) using Trizol (ThermoFisher, MA) and the Qiagen RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Cell Biology 2024Quote: ... or luciferase siRNA (5’ CGUACGCGGAAUACUUCGA 3’, control) were transfected in above RPE1 cells using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA in 2 ml of cell culture media ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...