Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) NucBlue (Cat. #: R37606; Thermo Fisher Scientific). Slides were mounted using Aqua-Poly/Mount (Cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... After another set of gentle washes and 4′,6-diamidino-2-phenylindole (DAPI) nuclear staining (Thermo Scientific, R37606 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were visualized with 4′,6-diamidino-2-phenylindole (DAPI) in SlowFade Diamond antifade mounting medium (ThermoFisher). Primary antibodies were incubated with tissues overnight at 4°C in 1% normal donkey serum ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei staining was performed with 4’,6 diamidino-2-phenylindole dihydrochloride (DAPI, Molecular Probes, Eugene, OR, USA) at 300 nM in PBS ...
-
bioRxiv - Genomics 2024Quote: ... Sections were stained with DAPI (4 ',6' -diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Imaging was performed on a Nikon Eclipse Ti Confocal at 20X objective and processed using Nikon Elements-AR ...
-
bioRxiv - Microbiology 2024Quote: ... hMDM nuclei were stained with 50 ng/ml 4’,6-diamidino-2- phenylindole (DAPI) (Invitrogen Cat. # D1306) for 7 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear counterstain was performed using 300 nM DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Thermo Fisher # D1306).
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear counterstaining was performed using 300 nM DAPI (4’,6-Diamidino-2-Phenylindole, dihydrochloride) (Thermo Fisher # D1306).
-
bioRxiv - Biophysics 2024Quote: ... Samples were washed in PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Scientific, USA) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The cell nuclei was labelled by adding 4′,6-diamidino-2-phenylindole (DAPI, D1306, Thermo Fisher Scientific) for 15 min ...
-
bioRxiv - Bioengineering 2024Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole) and mounted with ClearMountTM mounting solution (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... followed by staining with 4’,6-diamidino-2-phenylindole (DAPI) nuclear dye (Thermo Fisher Scientific, Cat# D3571) for 5 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Bioengineering 2024Quote: ... for 2 h and a 1 µg mL−1 solution of 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific 62248) for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cultured neurons were transfected with plasmids (1.5 μg of plasmid DNA per well) at 4 - 5 d in vitro (DIV) using a commercial calcium phosphate transfection kit (Thermo Fisher Scientific) as previously described21,24.
-
bioRxiv - Microbiology 2023Quote: ... coverslips were washed once with 0.1M MOPS buffer (pH 3) and stained with 50 μg / ml 5,(6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen) in MOPS buffer for 1 h at 37°C in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen). Slides were mounted in ProLong® Gold antifade reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) was used for nuclear counterstaining ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After PBS washing ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After washing slides were mounted in Elvanol ...
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-6 (Invitrogen IL-6 Mouse ELISA kit, cat # BMS603-2) and TNFα (Invitrogen TNF alpha Mouse ELISA kit ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) phosphate buffered saline (PBS, pH 7.2; Thermo Fisher Scientific-Gibco 20012027) at 50°C without added MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) phosphate buffered saline (PBS, pH 7.2; Thermo Fisher Scientific-Gibco 20012027) at 50°C without added MgCl2 ...
-
bioRxiv - Physiology 2023Quote: ... mouse anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:50000, Thermo Fisher, AM4300), mouse anti-CASQ1 (1:5000 ...
-
bioRxiv - Bioengineering 2022Quote: ... HUVECs (passages 3-7) were washed with phosphate-buffered saline (PBS, ThermoFisher) and detached by trypsin/EDTA solution (ThermoFisher) ...
-
Tumor Spheroid Uptake of Fluorescent Nanodiamonds is limited by Mass Density: a 4D Light-Sheet AssaybioRxiv - Biophysics 2024Quote: Fully formed spheroids were rinsed 3 times with phosphate buffer saline (Gibco) and were supplemented with a cell impermeable dye (Alexa Fluor 488 Hydrazide ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Genetics 2024Quote: ... cell pellets were resuspended into PBS with 2% FBS and 1µg/ml of 4’,6-diamidino-2-phenylindol (DAPI) (Thermo Fisher Scientific, Cat#D1306) and transferred into 5 ml round bottom polystyrene flow tubes with cell strainer (Corning Life Sciences ...