Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Non-viable cells were excluded by staining with 4’,6-diamidino-2-phenylindole (Thermo Fisher, D1306). Flow-cytometric data were analyzed using FlowJo software (BD Biosciences).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were counterstained with 300nM 4’,6-diamidino-2-phenylindole dilactate (DAPI) (D1306, ThermoFisher Scientific, UK) for imaging assessment (Zeiss Axio observer Z1 microscope) ...
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... however Live/Dead stain was not performed and instead 4’-6’-diamidino-2-phenylindole (DAPI, ThermoFisher) was added immediately prior to sorting for live/dead detection ...
-
bioRxiv - Neuroscience 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) and Leica standard immersion oil were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were identified based on 4′,6-diamidino-2-phenylindole (DAPI; purchased from Thermo Fisher Scientific) staining before measurement of nuclear γH2AX and 53BP1 staining ...
-
bioRxiv - Microbiology 2022Quote: ... All stained sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, cat. no. D1306) at a concentration of 1 μg/mL for 15 minutes at room temperature and mounted using ProLong Glass Antifade Mountant (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... Tissues were counterstained with the nuclear marker 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen Cat# D1306) at a dilution of 1:1000 in diluent (Agilent Cat# S0809 ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining was done by 4’,6-diamidino-2-phenylindole (DAPI, catalog # D1306, Thermo Fisher Scientific). After several washes in 1xPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... single nucleus suspensions were stained with DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) at a concentration of 0.1μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 4x10min washes in PBS-Tr at RT with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) added during the third wash ...
-
bioRxiv - Cancer Biology 2024Quote: ... Counterstaining was done with 4’,6-diamidino-2-phenylindole ([DAPI], Thermo Fisher Scientific, #121101, 1µg/ml) for 15 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were mounted using Prolong Gold supplemented with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Specimens were examined on a Zeiss Axiovert 200M microscope and images captured with an Axio-Cam MRm camera ...
-
bioRxiv - Immunology 2024Quote: ... Dead cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA) (1.0 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... All IF sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, USA). Immunofluorescent images were acquired on an Olympus FV3000 microscope ...
-
bioRxiv - Immunology 2023Quote: ... Coverslips were exposed to 200 ng/mL 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62247) for 2 min to label nuclei ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed and stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571, 1:4000) in PBS for 10 min at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... Sections were mounted in Antifade Mounting Medium with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) and mounted in Antifade Mounting Medium ...
-
bioRxiv - Cell Biology 2023Quote: ... Gel surfaces were functionalized with sulfosuccinimidyl-6-(4′-azido-2′-nitrophenylamino) hexanoate (Sulfo-SANPAH, Thermo Scientific) and covalently coated with 300 μg ml-1 collagen-I (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-integrin β1 antibody and 4’,6-diamidino-2-phenylindole (DAPI) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then visualised using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) or 4 µM TO-PRO-3 Iodide (TOPRO ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coverslips were mounted with ProLong Gold antifade plus 4’,6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were counterstained with 0.3 µM 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies, OR, USA) for 15 minutes before rinsing with cold phosphate-buffered saline pH = 7.5 (Panum Institute Substrate Department ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were resuspended in PBS containing 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, #D1306) and analyzed with CytoFLEX Flow Cytometer (Beckman Coulter).
-
bioRxiv - Bioengineering 2023Quote: ... Hoechst 33342 trihydrochloride trihydrate and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... fetal bovine serum (FBS) and 4’,6-diamidino-2- phenylindole (DAPI) were purchased from Life Technologies. Antibiotics (penicillin/streptomycin ...
-
bioRxiv - Biophysics 2023Quote: ... covered with sulfosuccinimidyl 6(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (ThermoFisher Scientific, Loughborough, UK) 0.5 mg/mL in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... counterstaining was performed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Thermo Fisher Scientific, Cat# D1306) (1μg/ml ...
-
bioRxiv - Biophysics 2024Quote: ... Gel surfaces were functionalized with sulfosuccinimidyl-6-(4′-azido-2′-nitrophenylamino) hexanoate (Sulfo-SANPAH, ThermoFisher 22589) and coated overnight with collagen-I at 4 °C to ensure cell attachment ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI; D1306, Invitrogen, Thermo Fisher Scientific). Stained organoid unit sections were observed with optical sectioning fluorescence microscopy (Axio Observer 7 with Apotome 3 ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI; D1306, Invitrogen, Thermo Fisher Scientific). Stained organoid unit sections were observed with optical sectioning fluorescence microscopy (Axio Observer 7 with Apotome 3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... coverslips were mounted with ProLong Gold antifade plus 4’,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Images were captured using a DeltaVision Elite microscope equipped with a 60X ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissues were counterstained with the nuclear marker 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen Cat# D1306) at a dilution of 1:1000 in diluent (Agilent Cat# S0809 ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were visualized with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 0.2 μg/ml; Life Technologies). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... The nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI: Thermo Fisher Scientific Cat D1306). The use of P2Y13 ...
-
bioRxiv - Immunology 2024Quote: ... cell viability was measured using 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, Catalog No. 62248) where only dead cell nuclei would be labelled ...
-
bioRxiv - Cell Biology 2024Quote: ... ProLong Gold Diamond 4′,6-diamidino-2-phenylindole (DAPI) mounting media was purchased from Invitrogen (#P36962). Trpv4 antagonist GSK2193874 (GSK219 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant mouse Interleukin-6 (IL-6, 4 ng/mL, Thermo Fisher), recombinant human FMS like tyrosine kinase 3 ligand (FLT3-L ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...