Labshake search
Citations for Thermo Fisher :
6851 - 6900 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... After incubation at 37 °C for 30 minutes the mixture was transferred to a 96-well plate and turbidity was measured by absorption at 620 nm using a Multiskan FC microplate reader (Thermo Fisher, USA). All samples were examined in triplicates (n = 3).
-
bioRxiv - Physiology 2024Quote: ... Plate was incubated at 37°C for 5 min then absorbance was read at 540 nm (Thermo Scientific – Multiskan FC Microplate Photometer). For Stanbio kit ...
-
bioRxiv - Biophysics 2024Quote: A U2OS cell line was cultured on a 24-well FC plate (Zell-kontakt GmbH, Germany) in FluoroBrite DMEM (Thermo Fisher Scientific) supplemented with 10% FBS and 1× GlutaMAX™-I (GIBCO ...
-
bioRxiv - Bioengineering 2024Quote: ... resuspended in FACS buffer (PBS supplemented with 2 % FCS) and analyzed for transduction efficiency using an Attune NxT Flow Cytometer with autosampler (Thermo Fisher Scientific). Cells were subsequently sorted for eGFP expression ...
-
bioRxiv - Cell Biology 2024Quote: ... HCSF were cultured in complete in DMEM supplemented with 10% (v/v) foetal calf serum (FCS) and 1 % (w/v) penicillin/streptomycin (Gibco; ThermoFisher Scientific) at 37°C in a humidified atmosphere containing 5% CO2.
-
bioRxiv - Cell Biology 2024Quote: ... NHDF and laminopathy patient dermal fibroblasts were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Biowest, Nuaillé, France) containing 10% fetal calf serum (FCS) (Gibco, Waltham, MA, USA) and 50 µg/ml Gentamycin (Dechra ...
-
bioRxiv - Bioengineering 2021Quote: ... THP-1 cells were expanded in RPMI medium (ATCC® 30-2001™) supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Gibco, ThermoFisher Scientific, Massachusetts, USA), 100 U/ml penicillin and 100 μg/ml streptomycin sulfate (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... The eluted protein was then incubated with purified 6x-His-TEV protease E106G (Cabrita et al. 2007) and 500 μM TCEP (Thermo Fisher Scientific, product number 77720) for 20-24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Standard Western blotting procedures were used with the following antibodies: HIV-1 gp120 (NIH AIDS Reagent program catalog no. 288) and 6x-His Tag (ThermoFisher catalog no. MA1-21315-HRP).
-
bioRxiv - Immunology 2021Quote: ... with an N-terminal IL-2 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFUSE-vector (Invitrogen, Thermo Fischer Scientific, MA, USA). The human ACE2 was expressed by essentially the same protocol used for the COVID-19 RBD ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 Spike RBD, His, Avitag™ (ACRO Biosystems, SPD-C82E9) immobilized on paramagnetic beads (Dynabeads M-280 streptavidin; Invitrogen Dynal AS, Oslo, Norway) as target antigen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used the modified pSec-NtermHis6 vector containing secretory signal peptide (IgK Leader) as found originally in commercial vector pSecTag/FRT/V5- His-TOPOR vector (Thermo Fisher Scientific, Waltham, MA, USA), but fused to six histidine residues (His6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed once with 2% HI-FBS S-MEM and further stained with PE-conjugated anti-mouse IgM (Thermo Fisher Scientific, #12-5790-81) for 30 minutes to detect the HTII-280 primary antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... The large-scale cell culture and expression of CD95L-IZ-His was performed using a 10-layer cell culture vessel (Nunc™ EasyFill™ Cell Factory™ Systems, Thermo Fisher Scientific). Before using the cell factory ...
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA expression was analyzed based on 2-3 biological replicates each with 3 technical repeats using QuantStudio™ Design & Analysis Software (Thermo Fisher Scientific Inc.). The 18S-rRNA housekeeping gene was used as an internal reference gene ...
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... cells washed 3 times with EBSS (GIBCO BRL, 24,010–043) and replaced with EBSS or Live Cell Imaging Solution (Molecular Probes ...
-
bioRxiv - Immunology 2021Quote: ... and for Calu-3 cells was MEM (Thermo Fisher 11090081) supplemented with GlutaMAX ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the QuantStudio™ 3 Real-Time PCR System (ThermoFisher). Each target mRNA was quantified in three biological replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... Figure 3) and 0.8-1.5 μl Lipofectamine 2000 (Life Technologies). After 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... medium supplemented with 25 ng/ml IL-3 (PHC0031, ThermoFisher), 2 mM Glutamax (35050061 ...
-
bioRxiv - Biochemistry 2022Quote: PRL-3 nanobodies were coupled to Dynabeads (Life Technologies, 14311D) for downstream 3XFLAG-PRL immunoprecipitation following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed using a 3% agarose (Thermo Fisher, BP160) gel in 1X Tris-Borate EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Delipidated brains underwent nuclear counterstaining with TO-PRO-3 (ThermoFisher) for a day ...
-
bioRxiv - Cell Biology 2022Quote: ... and resolved using NativePAGE 3-12% Bis-Tris gels (Invitrogen). For SDS-PAGE ...
-
bioRxiv - Biophysics 2022Quote: ... equipped with a Falcon 3 direct electron detector (Thermo Fisher) operated in linear mode ...
-
bioRxiv - Cell Biology 2022Quote: ... stained with 3 μl of AnnexinV-PE conjugates (Thermo Fisher) and 0.1 μg/ml DAPI (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Borealin 3’ UTR siRNA (AGGUAGAGCUGUCUGUUCAdTdT) was transfected using RNAiMAX (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... then Liver Perfusion buffer (4ml/min for 3 minutes, Gibco), and finally the Liver Digest Medium (4ml/minute for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... and quantified by Qubit 3 Fluorometer (Thermo Fisher Scientific, Q10210). The purified DNA was sheared to a size of 250-450 bp by sonication using a Covaris M220 instrument (Covaris ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using a Qubit 3 Fluorometer (Thermo Fisher Scientific, MA, USA) and a Qubit Protein Assay Kit (#Q33211 ...