Labshake search
Citations for Thermo Fisher :
6701 - 6750 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Biophysics 2020Quote: ... The confocal parameters were calibrated daily by measuring the FCS decay of a 20 nM TAMRA (carboxylic acid of tetramethyl rhodamine) free dye solution (Molecular Probes, Inc.) with a known diffusion coefficient (D = 420 μm2s−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... FCS (10% FCS-DMEM/F-12) at 37°C under 5% CO2/95% air in a Heracell 150i CO2 incubator (Thermo Fisher Scientific). Cells were passaged every 2 days or once they had reached 80% confluency ...
-
bioRxiv - Immunology 2021Quote: ... Single cell suspensions were incubated with 5 μg/mL anti-mouse CD16/CD32 Fc block (clone 2.4G2, Thermo Fisher Scientific, Cat. #553142) for 15 minutes at 4°C per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Optical density of standards and samples were measured at OD595 nm using a Multiskan™ FC Microplate Absorbance Reader (Thermo Scientific, Belgium). Plasma and cell lysate were prepared by mixing 100 µl citrated plasma with 100 µl RIPA buffer and 6 × 106 HUVECs with 250 µl RIPA ...
-
bioRxiv - Microbiology 2022Quote: Expression plasmids encoding CLII or CLIV with an Fc- and His6-tag were transfected in Expi293F expression cells (Gibco-Thermo Fischer Scientific) using the ExpiFectamine293 transfection kit ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... cells were harvested by centrifugation (500 x g, 5 min) and washed with CO2-independent medium supplemented with 10 % FCS (Thermo Fisher Scientific). Afterwards ...
-
bioRxiv - Genomics 2019Quote: NIH3T3 and HEK293FT cells were cultured under standard conditions (DMEM; 10% FCS, 1% penicillin/streptomycin, all from Invitrogen; 37°C; 5% CO2).
-
bioRxiv - Immunology 2021Quote: ... immune cells in the 70-30% interphase were collected and washed twice with RP10 (RPMI 1640, Thermo Fisher; 10% FCS, 1% penicillin/streptomycin (Invitrogen, #15140122) 1% glutamine (Thermo Fisher ...
-
bioRxiv - Bioengineering 2020Quote: ... NKG2DL expression was assessed by staining with NKG2D-Fc chimera (10 µg / mL; Fisher 1299NK050) followed by an αFc secondary stain (Invitrogen #A-10631). NIR Live/Dead (ThermoFisher #L34976) ...
-
bioRxiv - Cell Biology 2021Quote: ... Akata cells were grown at 37°C under 5% CO2 in RPMI-1640 supplemented with 10% FCS and 2 mM of L-Glutamine (Gibco, 25030-081). Cells KD for BHRF1 were generated from Akata cells (see below ...
-
bioRxiv - Cell Biology 2021Quote: ... and A9 cells (obtained from Nobuo Takagi at Hokkaido University in 1980s) were cultured in DMEM (Nacalai Tesque) with 10% FCS (Thermo Fisher Scientific) and 1% GPS solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with heat-inactivated 10% v/v foetal calf serum (FCS; HyClone) and 500 μg/mL Geneticin (Gibco cat no 10131-0275) and kept under 5% CO2 at 37°C.
-
bioRxiv - Cell Biology 2020Quote: BM cells of C57Bl/6 donor mice were collected by flushing tibias and femurs by using 10 mL syringes (Terumo) filled with cell culture medium (DMEM, 10% FCS, 1% Penicillin-Streptomycin, 1% Antibiotic-Antimycotic, Thermo Fisher Scientific) (Kruger et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... The absorbance at a wavelength of 450 nm was measured using Multiskan™ FC Microplate Photometer (Thermo Fisher Scientific, Waltham, MA USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Protein bands were visualized using a LI-COR Biosciences Odyssey FC imaging system after the addition of SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific). Proteins were quantified with Image Studio Version 5.2.4 (LI-COR Biosciences) ...
-
bioRxiv - Cancer Biology 2022Quote: Whole lung single cell suspensions were passed through a 40 µm cell strainer and preincubated with anti-mouse CD16/CD32 Fc block (1:100, Thermo Fisher Scientific) for 15 min in flow buffer (PBS supplemented with 5% (vol/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... Sendai virus-infected primary fibroblasts were immediately centrifuged for 45 min at 32 °C with 1,500 g (spinfection) and cultivated in Advanced DMEM containing 5% fetal calf serum (FCS) and 1% GlutaMAX™ (all from Life Technologies). On the following day the viruscontaining medium was replaced with fresh culture medium ...
-
bioRxiv - Bioengineering 2020Quote: ... Pro + using an optimized autoinduction media and purified by protein A affinity chromatography similarly to Fabs.30 VH-Fc were expressed in Expi293 BirA cells using transient transfection (Expifectamine, Thermo Fisher Scientific). 4 days after transfection ...
-
bioRxiv - Immunology 2022Quote: ... were cultured in R10 medium (RPMI1640 [Gibco Life Technologies, 31870-025], 10% FCS, 2 mM glutamate [Gibco Life Technologies, 25030-024], 1 mM sodium pyruvate [Gibco Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... spun at 200 × g for 10 min and resuspended in macrophage medium (DMEM [Invitrogen] plus 10% FCS and 2 mM L-glutamine) in order to have 2.5 × 106 cells per well ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were seeded at a density of 2.7×104 cells/cm2 and cultured in William’s Medium E (Biochrom, Berlin, Germany) containing 10% (v/v) FCS (Life Technologies, Darmstadt, Germany), 5 mg/ml insulin (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: CIL in single cells encountering cadherin coated beads used cdh3-coated beads prepared by binding purified cdh3-fc (gifted from Dr. Douglas W. DeSimone and Dr. Barry. M. Gumbiner) to Protein A/G coated beads (53132, Thermo Fisher Scientific) (Chappuis-Flament et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were cultured in Dulbecco’s Modified Eagle Medium (DMEM, High Glucose, GlutaMAX™, Pyruvate) supplemented with antibiotics and 10% FCS (Gibco, Life technologies) and maintained in T75 Flasks at 1×106 cells per flask ...
-
bioRxiv - Cell Biology 2020Quote: ... NIH3T3 and RPE-1 were maintained in DMEM (HPSTA – high glucose, stable glutamine and sodium pyruvate; Capricorn Scientific) supplemented with 10% fetal calf serum (FCS; Thermo Fisher Scientific) under standard conditions at 37°C in a 5% CO2 environment ...
-
bioRxiv - Immunology 2020Quote: ... The plates were washed with PBS and blocked with R10 media (RPMI-1640 with 10% FCS, 1% Pen/Strep, 2mM L-Glutamine (all from Thermo Fisher Scientific)) for 30 minutes at RT before the addition of freshly isolated PBMCs ...
-
bioRxiv - Microbiology 2021Quote: ... OD595 was measured every 5 min at 37°C from cultures that underwent continuous shaking in a Multiskan™ FC Microplate Photometer (Thermo Scientific). Data were collected from at least two independent experiments with at least two replicates for each individual experimental condition.
-
bioRxiv - Immunology 2020Quote: ... Staining was performed on ice for 25 minutes in PBS with 2 % FCS using the following antibodies: 7- AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Immunology 2020Quote: ... at a concentration to give 100 to 250 foci per well in the virus only control wells was mixed 50:50 in 1% FCS MEM with 1 x antibiotic/antimycotic (Gibco, 15240-062) with serum doubling dilutions from 1:20 to 1:640 (or higher dependent on antibody levels ...
-
bioRxiv - Microbiology 2021Quote: ... Two photometric readings were conducted for each plate with a 540 nm filter on a Multiskan FC Microplate Photometer (Thermo Scientific 51119000). The protocol is a slightly modified version of an Enzymatic Assay of α-Amylase (https://www.sigmaaldrich.com/NL/en/technical-documents/protocol/protein-biology/enzyme-activity-assays/enzymatic-assay-of-a-amylase ...
-
bioRxiv - Immunology 2022Quote: ... 100 µl of 0.2 mM sulfuric acid was added to halt the enzymatic reactions and the optical densities (OD) of the contents in the wells were read at 450 nm using a Multiskan FC plate reader (Thermo Scientific, USA).
-
bioRxiv - Cell Biology 2022Quote: ... the absorbance of each well at 450 nm was measured with a microplate reader (Multiskan FC, Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... 10% FCS (BioConcept, Cat# 2-01F16-I) and 100 units/ml of penicillin and 100 µg/ml of streptomycin (Invitrogen, Cat# 15140122). Rat primary fibroblasts (REFs ...
-
bioRxiv - Microbiology 2022Quote: ... 4a3A cells were maintained at 27°C without CO2 in Insect-XPRESS™ Protein-free Insect Cell Medium complemented with heat-inactivated Fetal Calf Serum (FCS) (#A3840002 ThermoFisher Scientific). C6/36 cell line (ATCC ...
-
bioRxiv - Physiology 2024Quote: NIH-3T3 fibroblasts (3T3-FB, 1.0×104 cells) were cultured in 10 % FCS/DMEM (Gibco, Life Technologies, Life Technologies, Carlsbad, CA, US). 3T3-FB were incubated with MNP (E-SO-2-MNP ...
-
bioRxiv - Physiology 2024Quote: NIH-3T3 fibroblasts (3T3-FB, 1.0×104 cells) were cultured in 10 % FCS/DMEM (Gibco, Life Technologies, Life Technologies, Carlsbad, CA, US). 3T3-FB were incubated with MNP (E-SO-2-MNP ...