Labshake search
Citations for Thermo Fisher :
6751 - 6800 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Human IFN-β1A and IFN-λ1 were purchased from Thermo Fisher Scientific (catalog numbers PHC4244 and 34-8298-64 ...
-
bioRxiv - Immunology 2024Quote: ... and anti-caspase-1 (human, Thermo Fisher Scientific, MA547253, 1:500). Secondary antibodies include HRP-conjugated goat-anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Immunology 2024Quote: ... rat anti-human/mouse-AID (0.5mg/mL, 14-5959-80, Invitrogen), rabbit anti-alpha smooth muscle actin (SMA ...
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit anti-Human IgG DyLight™ 800 (Cat# SA5-10116, Thermofisher). For the appraisal of common painkillers drugs were as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complete human medium with 10% exosome depleted FBS (Gibco, Massachusetts, US) was replenished and device placed into incubator ...
-
bioRxiv - Immunology 2024Quote: ... and human IL-6 (Gibco, PeproTech, #200-06; 20 ng/mL). Prostaglandin E2 (PGE2 ...
-
bioRxiv - Systems Biology 2024Quote: ... Human THP-1 monocytes were cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: ... and cytokine levels were measured using Human Uncoated ELISA Kits (ThermoFisher) targeting IFNψ ...
-
bioRxiv - Molecular Biology 2024Quote: Human MET knockout HeLa cells were transiently transfected with Lipofectamine3000 (Invitrogen) according to the manufacturer’s protocols in a 6-well plate format ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 ng/ml human basic FGF recombinant protein (bFGF) (Gibco, 13256029), 2% B27 supplement (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 20 ng/ml human EGF recombinant protein (Gibco, PHG0314), 20 ng/ml human basic FGF recombinant protein (bFGF ...
-
bioRxiv - Biophysics 2024Quote: The human Gαi1 subunit was cloned into a pFastBac1 vector (Invitrogen), while the N-terminal 6×His-tagged wild-type human Gβ1 and untagged Gγ2 subunits were cloned into a pFastBac-Dual vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: Human CI-MPR plasmid was transfected to ExpiCHO cells (ThermoFisher, A29127) following the manufacturer’s protocol (ThermoFisher ...
-
bioRxiv - Genomics 2024Quote: ... Human THP-1 monocytes were cultured in RPMI 1640 medium (Gibco; ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and activated with Dynabeads Human T-Activator CD3/CD28 beads (Gibco). T cells were cultured in RPMI supplemented with GlutaMAX (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: ... human VEGF-A ELISA kit (BMS277-2, Lot. 276933-006 Invitrogen), human PDGF-BB ELISA kit (RAB0397-1KT ...
-
bioRxiv - Bioengineering 2024Quote: Human iPS cells were harvested with Accutase (Thermo/Life Technologies; A1110501) and reseeded on Matrigel-coated 6-well plates at a cell density of 420,000 cells/well ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-human ⍺SMA antibody (1:250; 14-9760-82, Invitrogen), Alexa Fluor 647 goat anti-mouse (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.1 μg/mL recombinant human Noggin (all Thermo Fisher Scientific). PTOs were routinely passaged upon confluency ...
-
bioRxiv - Genetics 2024Quote: ... The primer-probe sets of human transcripts purchased from Life Technologies include peptidylprolyl isomerase A (PPIA ...
-
bioRxiv - Cell Biology 2024Quote: TNF-α was quantified using human TNFα ELISA kit (Thermofisher, CHC1753), as per manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: CXCL8 was quantified using human IL-8 ELISA kit (Thermofisher, CHC1303), as per manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... The probe was biotin labeled at the 3’ end using a Pierce™ Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific Inc.). Seven micrograms of nuclear protein were added to a binding reaction mixture containing 2µl 10X binding buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured by caspase-3/7 staining using CellEvent® Caspase-3/7 Green ReadyProbes® Reagent (ThermoFisher Scientific Inc., cat# R37111). CHLA20 and NGP cells were grown until confluence on 6-well plates with six days of treatment with DMSO or GSK591 ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cancer Biology 2024Quote: ... 48hrs after transfection the cells were fixed and stained for activated Caspase-3/7 using Apoptosis CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) according to manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was replaced every 2-3 days and cells passaged 1:2 or 1:3 weekly with 0.25% Trypsin/EDTA (Thermo Fisher Scientific, #25200-056) pre-warmed at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Bioengineering 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass, 3 µg total plasmid) using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). Media was exchanged after 6 hours and viral supernatant was harvested 48 hours after transfection and filtered through 0.45 μm cellulose-acetate filters (VWR cat ...
-
bioRxiv - Biophysics 2020Quote: ... The confocal parameters were calibrated daily by measuring the FCS decay of a 20 nM TAMRA (carboxylic acid of tetramethyl rhodamine) free dye solution (Molecular Probes, Inc.) with a known diffusion coefficient (D = 420 μm2s−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... FCS (10% FCS-DMEM/F-12) at 37°C under 5% CO2/95% air in a Heracell 150i CO2 incubator (Thermo Fisher Scientific). Cells were passaged every 2 days or once they had reached 80% confluency ...
-
bioRxiv - Immunology 2021Quote: ... Single cell suspensions were incubated with 5 μg/mL anti-mouse CD16/CD32 Fc block (clone 2.4G2, Thermo Fisher Scientific, Cat. #553142) for 15 minutes at 4°C per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Optical density of standards and samples were measured at OD595 nm using a Multiskan™ FC Microplate Absorbance Reader (Thermo Scientific, Belgium). Plasma and cell lysate were prepared by mixing 100 µl citrated plasma with 100 µl RIPA buffer and 6 × 106 HUVECs with 250 µl RIPA ...