Labshake search
Citations for Thermo Fisher :
6551 - 6600 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... and passed to the plating medium consisting of 5% horse serum and 5% fetal calf serum prepared in minimum essential medium (MEM, Gibco), enriched with 0.6% glucose ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transfected in suspension with 50 pmol per 3×105 cells of scrambled siRNAs (control, 5’UUCUCCGAACGUGUCACGU3’) or siRNAs specific for JIP4 (5’GAGCAUGUCUUUACAGAUCUU3’) using the transfection reagent LipofectamineR 2000 (Invitrogen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Control (vehicle: 40 μM HCL, 0.002% BSA [0-5 d]; 0.1% DMSO [5-10 d]; all from Thermo Fisher Scientific) for 0-10 d [=Baseline] ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 mM NaCl, 5 mM MgCl2, 5% glycerol, 0.5% Triton X-100, and 1X Halt protease/phosphatase inhibitor cocktail, Thermo Scientific) using a pre-cooled mortar and pestle ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were hybridized at 42 °C with 5 nM of a 5’-biotinylated oligonucleotide probe (Table S4) in ULTRAhyb Ultrasensitive Hybridization Buffer (Ambion) and then washed according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (ThermoFisher), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 × 106 KH2 ESCs were electroporated with 5 μg of pBS31–TetON plasmid and 5 μg of pCAGgs–FLPe plasmid using the Neon system (Invitrogen) with two impulses (20 ms ...
-
bioRxiv - Neuroscience 2019Quote: ... The following day sections were washed 5×5 in 0.1M PBS and incubated in goat-anti-mouse CY3 conjugated IgG (Invitrogen A32727) diluted 1:500 at room temperature for 1hr ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Biophysics 2019Quote: ... The protein was buffer exchanged 2-3x using either 7 kDa MWCO Zeba Columns for EC1-5/EC3-5 proteins or 40 kDa MWCO Zeba Columns for full length proteins (ThermoFisher).
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (5 µg) was combined with ERCC Spike-In Standards (5 µl of 1:50 diluted stock solution; Invitrogen) and submitted to the University of Minnesota Genomics Center for library generation and sequencing ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample was concentrated over an Acclaim PepMap C18 pre-column (5 μm particle size, 0.3 mm ID x 5 mm length, ThermoFisher Scientific) then bound to a 50 cm EasySpray C18 analytical column (2 μm particle size ...
-
bioRxiv - Immunology 2020Quote: Crosslinked samples were reconstituted in 5% FA/5% acetonitrile (ACN) and analysed in the Orbitrap Fusion Lumos Mass Spectrometer (ThermoFisher) coupled to an EASY-nLC 1200 (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... After the fourth EDTA incubation the pieces were cut into 2 mm2 pieces and placed in 5 mL digestion solution containing 5% fetal bovine serum (Gibco), 10 mM HEPES (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: To prepare the probe for hybridisation approximately 200-600ng of labelled probe DNA was ethanol precipitated with the 5 µg of sheared salmon sperm DNA and 5 µg of mouse or human Cot1 DNA (both from Invitrogen) and resuspended in hybridisation buffer (50% formamide ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... at a density of 5 million cells/mL and cultured at 37°C with 5% CO2 in RPMI 1640 containing glutamine (Invitrogen), supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Genomics 2022Quote: ... We removed the supernatant and then resuspended the pellet in 200 μl of FACS buffer (PBS supplemented with 5% BSA and 5 mM EDTA) supplemented with 1U/μl SUPERase.in (Invitrogen, AM2696). Spermatogonia were sorted according to (Kanatsu-Shinohara et al ...
-
bioRxiv - Immunology 2022Quote: ... PCR of the precipitated product (5 ng) was performed using a reaction with 5 μL SyBR green (#A25742; ThermoFisher Scientific) and 0.5 μL of 10 μM primer listed in the Supplementary table 3 ...
-
bioRxiv - Microbiology 2022Quote: ... The plates were fixed with 4% w/v formaldehyde for 15 min and stained with 5 μg/mL DAPI and 5 μg/mL CellMask deep red plasma membrane stain (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Physiology 2022Quote: ... Total of 0.5–0.7 mL blood was collected from the heart and stored in 0.75 mL tubes containing 5 µL EDTA and 5 µL Halt protease and phosphatase inhibitor cocktail (100x, Thermo Scientific). The tubes were centrifuged for 10 minutes (2000 x G ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAVs were measured relative to standards with primers targeted to the ITRs (forward: 5′-GGAACCCCTAGTGATGGAGTT, reverse: 5′-CGGCCTCAGTGAGCGA) with the SYBR Green PCR Master Mix (ThermoFisher). qPCR was performed on the StepOnePlus real-time PCR system ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 μL of cDNA (12.5 ng) were added to 7.5 μL of a master mix containing 5 μL of Taqman (11732-020, Applied Biosystems) and 2.5 μL of nuclease-free water containing golden hamster’s primer pairs (Table S2) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of each sample was loaded on a C18 precolumn (300 µm inner diameter × 5 mm, Thermo Fisher Scientific) in a solvent made of 2% acetonitrile and 0.05% trifluoroacetic acid ...
-
bioRxiv - Molecular Biology 2024Quote: ... boiled at 95°C for 5 mins and spun at 21 300 rcf for 5 mins prior to loading in NuPAGE Tris-Acetate gels (Invitrogen). Gels were run at 150 V for 1 h and transferred onto 0.2 µm PVDF membranes using the High MW setting on the Trans-Blot Turbo (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μL/min ...
-
bioRxiv - Molecular Biology 2024Quote: ... about 5 million K562 cells were transfected with 5 μg luciferase reporter plasmid using Neon™ NxT Electroporation System (Invitrogen). Cells were fixed after 24 hours and ChIP performed as described above ...
-
bioRxiv - Microbiology 2024Quote: ... GP2-293 cells were seeded at 5×106 on 10-cm plates and transfected 24 h later with 5 µg of LUJV-flag/LUJV-flag-mut and 5 µg Luciferase using Lipofectamine 2000 (Invitrogen). Cells’ media were replaced 5 h later to full medium ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were trapped on a µPrecolumn C18 PepMap100 (5 μm, 100 Å, 300 μm×5 mm, ThermoFisher Scientific, Reinach, Switzerland) and separated by backflush on a C18 column (5 μm ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 10 μl/min ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...