Labshake search
Citations for Thermo Fisher :
6451 - 6500 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: In each well of 24-well gelatin-coated plates (Nunc), we plated 5 × 105 C57BL6J ES cells with knocked-in mNeonGreen (GFP ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured in 24-well plates in DMEM (Gibco), 10% FBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Plates were blocked with 10% FBS in complete RPMI (GIBCO). Cells from various tissues were serially diluted in complete RPMI and plated onto coated ELISPOT plates and incubated at 37°C overnight ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we coated six-well plates with poly-D-lysine (Gibco) following manufacturer’s recommendations before seeding 4x105 HEK293T cells each well ...
-
bioRxiv - Neuroscience 2023Quote: ... in a 24-well plate (ThermoScientific) in Neurobasal Medium (Gibco), supplemented with 10% Horse serum (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... Assays were performed on 384-well MaxiSorp clear plates (ThermoFisher). Plates were coated with well-characterized capture antibodies (α-synuclein ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were seeded in white 96-well plates (Fisher Scientific) at 1 x 104 cell per well and treated with each ferroptosis inducers (RSL3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... in a 24-well cell culture plate (Corning, Thermo scientific). Alternatively ...
-
bioRxiv - Bioengineering 2023Quote: Adhesive PCR plate foils (Thermo Fisher Scientific, cat. no: AB0626)
-
bioRxiv - Microbiology 2023Quote: ... a 96 well plate (MaxiSorp; Nunc, Thermo Fisher Scientific, Germany) was coated with 10 μg/mL of a capture antibody in 50 μL Phosphate Buffered Saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... a 96 well plate (MaxiSorp; Nunc, Thermo Fisher Scientific, Germany) was coated with 10 μg/mL of a capture antibody in 50 μL Phosphate Buffered Saline (PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... They were transferred to plates with HBSS (Life Technologies, 14175053) and 5% FBS for removal of the shell coat and most of the extraembryonic tissues (except for E8.5 embryos where extraembryonic tissues were kept) ...
-
bioRxiv - Molecular Biology 2024Quote: ... In a black 96-well plate (Fisher Scientific Cat: 655900), 200 pmols of the fluorescent oligo(s ...
-
bioRxiv - Cell Biology 2024Quote: ... coated 6 well plates and maintained in StemFlex (Thermo Scientific) media at 37 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... EBs were adhered to CELLstart coated plates (Thermo Fisher Scientific). BMP4 was gradually transitioned out of the NIM over seven days ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were cultured on GelTrex™-coated plates (Thermo Fisher) in iPS-Brew XF (StemMACS™ ...
-
bioRxiv - Immunology 2024Quote: ... Corning 96-well flat bottom assay plate (Thermo Fisher Scientific) were coated with ∼95,000 infectious unit (IU ...
-
bioRxiv - Immunology 2024Quote: ... each well of a 96-well microtiter plate (Thermo Fisher) was coated with 100 μl of fetuin (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... streaked onto Horse Blood Agar Columbia (HBA) plates (ThermoFisher Scientific), and incubated at 35°C for 16 ± 2 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... transferred to 96-well U-bottom Falcon plates (Fisher Scientific), and analyzed on a BD FACSCanto II flow cytometry system (BD Biosciences) ...
-
bioRxiv - Developmental Biology 2024Quote: ... on Geltrex matrix coated plates (10 μg/cm2, Life Technologies) at 37°C in a humidified atmosphere of 5% CO2 in air ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the plates were covered with breathable adhesive seals (ThermoFisher Scientific) and then placed in the incubator at 28.5°C with a light/dark cycle ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated in NBA (1.5ml) in 12-well plates (ThermoFisher).
-
bioRxiv - Immunology 2024Quote: ... Three hundred eighty four well plates (Thermo Fisher Scientific #460372) were coated with 7500 lysed gametes / gametocytes per well ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... desalted on a C8 column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific), and separated on a C18 column (Acclaim PepMap ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 10 minutes and blocked with DPBS containing 5% BSA and 5% normal goat serum (Gibco), for 30 mins at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 pmol was 5’-end labeled with 20 μCi of Ψ-P32 ATP using Polynucleotide Kinase (Thermo Fisher) and subsequently purified using an Illustra MicroSpin G-50 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) with an Acclaim PepMap C18 trap column (0.3 mm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific). The mobile phases were A ...
-
bioRxiv - Bioengineering 2019Quote: ... The montaged image in Figure 5 C ii and 5 C iii were generated by stitching together individual images using MAPS 1.1 software (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Microbiology 2024Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml leupeptin and 5 µg/ml E-64) and HALT phosphatase inhibitor (Thermo Fisher Scientific, Waltham, MA). Detergents were NP-40 or Brij 96V (both from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...