Labshake search
Citations for Thermo Fisher :
6501 - 6550 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Microbiology 2023Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO] ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... Peptides were loaded onto a trap column (C18 PepMap100, 5 μm, 100 Å, 5 mm × 300 μm, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Cancer Biology 2020Quote: ... as per the commercial protocol) and 5 μL of fluorescent tag kit (Alexa Fluor® succinimidyl esters, Invitrogen, Molecular Probes®; as per the commercial protocol). Labeled protein then was dialysed overnight in Slide-A-Lyzer MINI Dialysis Device ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of each mixed culture was aliquoted into a 96-well plate and GFP fluorescence and optical density (at 600 nm) was estimated in a multi-mode plate reader (Varioskan-Thermo Scientific or Enlight-Perkin Elmer). For each individual experiment 2 controls were maintained ...
-
bioRxiv - Microbiology 2022Quote: ... in an Applied Biosystems™MicroAmp™ Optical 96-Well Reaction Plate followed by plate sealing with MicroAmp™ Optical Adhesive Film (Applied Biosystems, 4360954) and loading into the QuantStudio 7 Pro Thermal Cycler for RT-qPCR analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... The unbound fraction was aspirated from the resin with 500 ul of 100 mM NH4CO3 and transferred to a filter plate (Nunc™ 96-Well Filter Plates). The depleted fraction was collected by gentle centrifugation (100 rcf for 2 min ...
-
bioRxiv - Immunology 2022Quote: ... DC media and 2×104 cells/well were transferred to a fluorospot plate for cytokine secretion analysis and to a 96-well plate (Nunclon™ Delta surface, Thermo Fisher Scientific, Roskilde, Denmark) for proliferation analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... Propidium iodide was added at a concentration of 10 µg/ml and 50 µL of the propidium iodide cell mixture was quickly added to a pre-prepared 96-well plate (NUNC black-walled clear bottom plate) that contained 50 µl of various peptide concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... Propidium iodide was added at a concentration of 10 μg/ml and 50 μL of the propidium iodide cell mixture was quickly added to a pre-prepared 96-well plate (NUNC black-walled clear bottom plate) that contained 50 μl of various peptide concentrations ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beas-2B cells were cultured at 37°C in a humidified atmosphere of 5% in serum-free 1× defined keratinocyte SFM Gibco) supplemented with 5 µg/mL gentamicin (Gibco). The medium was replaced every 2–3 days and cells were passaged every 4–5 days ...
-
bioRxiv - Microbiology 2022Quote: ... Health and Nutrition (Japan) and cultured at 37 °C with 5% CO2 in DMEM (WAKO) containing 5% fetal bovine serum (Gibco) and penicillin/streptomycin (100 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digests were allowed to stand for 5 min at room temperature and the supernatants were added to 5 ml of foetal bovine serum (FBS; Gibco) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Triton X-100 for 5 min and incubated with a blocking buffer containing PBS and 5% normal goat serum (31873; Invitrogen) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 400 rcf for 5 minutes and resuspended in cold flow cytometry buffer (calcium free HBSS with 5% fetal bovine serum (FBS, Gibco), 2 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... mice were woken up to allow any fecal matter to evacuate and then anesthetized again to introduce 100μL of Cy-5-labelled glucose or Cy-5 secondary goat anti-rat antibody (0.1mM diluted in PBS, ThermoFisher A10525) into the colon via a gavage needle enema ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... native gels were run with 5 μL per well of a 1:5:1 mixture of sample:water:BlueJuice loading dye (Thermo Fisher Scientific) in a 10% TBE ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... The coverslip with the sample was then inverted into the center of an imaging dish containing 150 μL of imaging buffer (Tyrode’s with 5% cosmic calf serum and 5 μg/mL Hoechst 34580 (Invitrogen #H21486), mixed by pipette and vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions were loaded onto a cartridge precolumn (5 mm x ID 300 μm, C18 PepMap 100 A, 5 μm particles (ThermoFisher)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were injected onto a PepMap100 trap column (0.3 x 5 mm packed with 5 μm C18 resin; Thermo Scientific), and peptides were separated by reversed phase HPLC on a BEH C18 nanocapillary analytical column (75 μm i.d ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were trapped and desalted on a C18-column (5 μm Acclaim PepMap100 300 μm x 5 mm, ThermoFisher Scientific) at a flow rate of 30 μl/min with solution A (1% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 along with penicillin and streptomycin antibiotics (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... One milliliter of the culture was incubated for 5 min (at 37°C) with the membrane dye Nile Red (5 µg/ml, Invitrogen), washed once with phosphate buffered saline (PBS) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μl/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... site-directed mutagenesis was performed as described in Liu & Naismith (32) using primers 5’-ACTACTTCGATGAGATCGCTCTGCTCATGAACCGTCCTCGTGCTG and 5’-AGCGATCTCATCGAAGTAGTCAGACGGTGCGAGTCTTCCAACCTC using Phusion Plus DNA polymerase (#F630S, ThermoFisher). Following confirmation of the RIαB G323D mutation by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... They have been regularly screened for mycoplasma infection using a PCR-based method with the primers Myco1 (5’-GGCGAATGGGTGAGTAACACG) and Myco2 (5’-CGGATAACGCTTGCGACTATG) (Invitrogen) and no cultures have tested positive.
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from an isolated two-kidney pool from each litter of the NP (n = 5) and LP (n = 5) offspring using Trizol reagent (Invitrogen), according to the instructions specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated in 5 ml of PBS containing 5 mg EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... epidermidis isolates collected from ocular sources were cultured in 5 ml of brain heart infusion broth (BHI) +5% fetal bovine serum (FBS, Gibco) and shaken at 250 rpm and 37°C for 12–16 h ...