Labshake search
Citations for Thermo Fisher :
6501 - 6550 of 10000+ citations for Glutathione Fluorescent Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The biotin signals on the membrane were detected using the chemiluminescent nucleic acid detection module (Thermo Fisher, 89880).
-
bioRxiv - Neuroscience 2023Quote: ... at 0.2 µg/mL as capture antibody and for detection rabbit anti-hPGRN (Thermo Fisher Scientific, 40-3400) or a rat anti-mPGRN (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... and amplified byPCR using SYBR® Green PCR Master Mix and ABI Prism7900HT sequence detection system (Applied Biosystems), with the primers shown in Table S1 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... Protein detection was done with enhanced chemiluminescence (ECL) using Pierce™ ECL Western Blotting-Substrate (Thermo Fisher Scientific). For stripping of membranes ...
-
bioRxiv - Physiology 2024Quote: ... The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad). Primers were designed using the Primer Express Software (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... cDNA samples were loaded in triplicate and qPCR was performed with the ViiA7 Sequence Detection system (Applied Biosystems), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: Detection of ROS levels was conducted using CellROX Deep Red according to the manufacturer’s protocol (C10422, Thermo Scientific). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample protein content was determined with the Pierce detection assay (Pierce 660 nm Protein Assay Reagent (ThermoFisher Scientific), complemented with Ionic Detergent Compatibility Reagent (IDCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Feature detection and peak alignment from .Raw files were performed using Compound Discoverer 3.1 (Thermo Fisher Scientific, Waltham). Files were also converted to .mgf format using MSConvert software (ProteoWizard ...
-
bioRxiv - Neuroscience 2024Quote: ... The reactions were run in an ABI PRISM 7000 sequence detection system (PE Applied Biosystems, Foster City, California). Alternatively ...
-
bioRxiv - Microbiology 2024Quote: ... Blots were imaged on a ChemiDoc (SynGene) using chemiluminescence detection with ECL western blotting substrate (Thermo Scientific, 34095).
-
bioRxiv - Cell Biology 2019Quote: Relative gene expression was determined using Taqman RNA-to-Ct 1-step kit (ThermoFisher) with TaqMan gene expression assays for CDKN1A (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... amplified using the TaqMan Fast Virus 1-Step Master Mix qRT-PCR kit (Invitrogen) on a LightCycler 480 or LC96 instrument (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... Mitochondrial membrane potential was analyzed with a Mitoprobe™ JC-1 Assay kit (Invitrogen). Nuclear condensation was assessed by staining with the Hoechst® dye (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: pos-1 dsRNA was synthesized in vitro using a MEGAscript T7 Transcription Kit (Invitrogen). The transcription template was PCR-amplified from the Ahringer pos-1 RNAi clone and contained the pos-1 insert sequence as well as the flanking T7 promoters ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of DNase I-treated RNA (Ambion DNA-free DNA removal kit (Invitrogen)) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of DNase I-treated RNA (Ambion DNA-free DNA removal kit (Invitrogen)) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... TRA-1-60 with PSC 4-Marker Immunocytochemistry Kit (Life Technologies, A24881, lot 1610720) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of genomic DNA extracted using the PureLink Genomic DNA Mini Kit (Invitrogen) was bisulfite-converted by using the Epimark Methylation kit (NEB) ...
-
bioRxiv - Pathology 2019Quote: ... DNA concentrations were concentration of 1-2nM using the SequalPrep™ Normalization Kit (Invitrogen). Samples were pooled into a single library which was analyzed using the TapeStation 4200 High Sensitivity D1000 assay (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... or Power SYBR® Green RNA-to-CT™ 1-Step Kit (ThermoFisher Scientific) and LightCycler® 96 (Roche ...
-
bioRxiv - Pathology 2021Quote: ... beads were washed with LWB 1× buffer (Dynabeads® Co-Immunoprecipitation Kit (Life Technologies)) and incubated 5 min at RT under gentle rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoprecipitation of Cav-1 was performed using Dynabeads™ Protein G Kit (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the Live/DeadTM Fixable Violet Dead Cell Stain Kit (1:1000; Invitrogen, L34955) in 100 μL of stain buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... was also used with the TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems). For a complete list of primer names and sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Thermal cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher, AB4101C) per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... fix viability dye (LIVE/DEAD Fixable Aqua Dead Cell Stain Kit; 1:200; Invitrogen) and conjugated antibodies were added (see below ...
-
bioRxiv - Immunology 2019Quote: THP-1 cells were transfected with siRNAs using the Lipofectamine2000 Kit (Invitrogen, #11668-019) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA (1 μg) was reverse transcribed using the Verso cDNA Synthesis Kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... We used the TaqMan® RNA-to-Ct™ 1-Step Kit (Applied Biosystems® by Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5–1 μg was retrotranscribed using the TaqMan reverse transcription kit (Applied Biosystems). Real-time qPCR was performed using primers (MmDrosha Fw:5’ TGCAAGGCAATACGTGTCATAG 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-miR-181a-1 in vitro synthesis was performed using T7 MEGAshortscriptTM kit (Ambion) from 1 µg purified DNA and following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 µg of RNA was treated with 1 µl of DNAse (Invitrogen TURBO kit) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... using a Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific), which also contains RNase inhibitor and ROX dye for passive referencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was used to make cDNA (SuperScript VILO cDNA Synthesis Kit, Invitrogen). Quantitative RT-PCR was performed with iTAQ Syber Green using 1/40th of the cDNA reaction per sample and the appropriate primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were quantified by Qubit 1× dsDNA HS Assay kit (#Q33230, Thermo Fisher Scientific). The libraries for each sample were pooled at 4 nm concentration and sequenced using an Illumina NovaSeq 6000 system (S4 PE150) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mitochondrial membrane potential was calculated using the MitoProbe JC-1 assay kit (Thermo Fisher). All media and oil were pre-equilibrated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... mRNA levels were determined using Taqman RNA-to-Ct 1-step Kit (Applied Biosystems) following manufacturer’s guidelines.
-
bioRxiv - Cell Biology 2023Quote: ... and 1 μg reverse transcribed using the MMLV reverse transcriptase kit (#28025021; ThermoFisher scientific). TNFα ...
-
bioRxiv - Biophysics 2023Quote: ... an MMP reporter dye that targets mitochondria [49] (ThermoFisher, Mitoprobe JC-1 assay kit), to the control and treated groups ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were quantified by Qubit 1× dsDNA HS Assay kit (#Q33230, Thermo Fisher Scientific). The libraries for each sample were pooled at 4 nm concentration and sequenced using an Illumina NovaSeq 6000 system (S4 PE150) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HET(1) and HET(2) hESCs was extracted using mirVana microRNA isolation kit (ThermoFisher). Small RNA libraries were generated using NEXTFlex Small RNA Library Prep Kit v3 (Cat #NOVA-5132–06 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... medium was removed and cells were lysed directly on plate in RNA lysis buffer and processed using the MagMAX® mirVana Total RNA Isolation Kit (Thermo Fisher Scientific Inc., Cat. No. A27828) according to the manufacturer’s instructions ...