Labshake search
Citations for Thermo Fisher :
6151 - 6200 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and resuspended in complete medium (RPMI 1640 supplemented with 10% fetal calf serum, FCS, 100 U/mL penicillin and 100 μg/mL streptomycin; Sigma-Aldrich and Invitrogen respectively).
-
bioRxiv - Microbiology 2024Quote: ... 250 μL of each sample was transferred into individual wells of a clear bottomed 96-well plate and the absorbance read at 620 nm (Multiskan FC, Thermo Fisher Scientific). Experimental glycogen concentrations were calculated off the standard curve (Herrmann & Gehringer ...
-
bioRxiv - Microbiology 2024Quote: ... The plate was incubated at room temperature for 10 min after which the absorbance at 595 nm was determined (Multiskan FC, Thermo Fisher Scientific). Experimental protein concentrations were read off the standard curve (Herrmann & Gehringer ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were selected for three passages in DMEM supplemented with 10% FCS and 500 μg/mL G418 sulfate (ThermoFisher Scientific, 10131027). The extent of overexpression was assessed with flow cytometry (Suppl ...
-
bioRxiv - Immunology 2023Quote: ... Isolated T-cells were resuspended in complete RPMI (RPMI 1640 [Gibco, #21870-076] supplemented with 2% FCS and 100x Penicillin-Streptomycin [Gibco, #10378-016]).
-
bioRxiv - Bioengineering 2023Quote: ... TF-1 were purchased from DSMZ (Cat#ACC334) and maintained in RPMI-1640 media supplemented with 10% heat-inactivated FCS (Gibco Life Technologies), 2mM GlutaMAX and 2ng/ml hGM-CSF (215-GM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Uveal melanoma cell lines were maintained in RPMI and cutaneous melanoma cells and HeLa cells were cultured in DMEM supplemented with 10% FCS (Thermo Fisher Scientific) and 1% penicillin/streptomycin (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% fetal calf serum (FCS)(AMIMED, BioConcept, Switzerland) and penicillin (100 U/ml)-streptomycin (100 µg/ml)(Gibco, Life Technologies). The MA104/NSP5-BioID2 cell line was generated using a lentiviral system ...
-
bioRxiv - Genomics 2023Quote: Lymphoblastoid cell lines (LCLs) from healthy donors and ICF2 patients were cultured in RPMI 1640 supplemented with 15% FCS and antibiotics (Thermo Fisher Scientific) as described in (15).
-
bioRxiv - Immunology 2023Quote: ... Single cell suspensions were incubated with 5 μg/mL anti-mouse CD16/CD32 Fc block (clone 2.4G2, Thermo Fisher Scientific, Cat. #553142) for 15 minutes at 4°C per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... plus 10 % FCS (PAA Laboratories; Pasching, Austria) and P/S (100 U/ml penicillin and 100 mg/ml streptomycin; Gibco, Thermo Fisher Scientific). Results with HeLa K are shown in Fig ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 10% FCS (Biosera, #FB-1280/500) and 2% glutamate/pyruvate (100mM sodium pyruvate, Invitrogen #11360-039; 200mM L-glutamine, Invitrogen, #25030-024). Slides were imaged for brightfield ...
-
bioRxiv - Bioengineering 2024Quote: ... and human and mouse DKK3 (hDKK3: AA 1-350, mDKK3: AA 1-349) triple tagged with Fc-Myc-6xHis were transfected into Expi293FTM (Thermo Fisher Scientific) cells at a density of 3 × 106 viable cells/mL using ExpiFectamineTM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were kept in MEM Alpha Medium supplemented with 10% fetal calf serum (FCS) and 1% penicillin/streptomycin (Invitrogen GmbH, Darmstadt, Germany) in a humidified atmosphere at 5% CO2 and 37°C ...
-
bioRxiv - Physiology 2023Quote: ... The formazan crystal pellets were dissolved in DMSO and the plate was read 10 min later using Multiskan FC Microplate Photometer (Thermo Fisher, USA) at 550 nm.
-
bioRxiv - Immunology 2023Quote: ... and resuspended in complete medium (RPMI 1640 supplemented with 10% fetal calf serum, FCS, 100 U/mL penicillin and 100 μg/mL streptomycin; Sigma-Aldrich and Invitrogen respectively). After the isolation ...
-
bioRxiv - Molecular Biology 2024Quote: ... were isolated from mice tibias and femurs as described previously29 and cultured for 7 days in Iscove’s Modified Dulbecco’s Medium supplemented with 10% FCS (Thermo Scientific, Rockford, IL, USA), penicillin-streptomycin (100 U/mL and 100 μg/mL ...
-
bioRxiv - Immunology 2024Quote: ... viremia samples or organ samples in 96-well plates in MEM (Sigma, M0446; supplemented with 2 % FCS and 1 % Penicilline/ Streptomycin (P/S; ThermoFisher, 15140-122)) ...
-
bioRxiv - Cell Biology 2024Quote: ... After incubation at 37 °C for 30 minutes the mixture was transferred to a 96-well plate and turbidity was measured by absorption at 620 nm using a Multiskan FC microplate reader (Thermo Fisher, USA). All samples were examined in triplicates (n = 3).
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293FT and HeLa cells were cultured under standard conditions (DMEM; 10 % FCS, 1 % penicillin/streptomycin, all from Invitrogen; 37 °C; 5 % CO2). The HeLa Denr knockout (KO ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 10% fetal calf serum (FCS)(AMIMED, BioConcept, Switzerland) and penicillin (100 U/ml)-streptomycin (100 µg/ml)(Gibco, Life Technologies). MA/cytBirA (24 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Bioengineering 2021Quote: ... THP-1 cells were expanded in RPMI medium (ATCC® 30-2001™) supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Gibco, ThermoFisher Scientific, Massachusetts, USA), 100 U/ml penicillin and 100 μg/ml streptomycin sulfate (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... The eluted protein was then incubated with purified 6x-His-TEV protease E106G (Cabrita et al. 2007) and 500 μM TCEP (Thermo Fisher Scientific, product number 77720) for 20-24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Standard Western blotting procedures were used with the following antibodies: HIV-1 gp120 (NIH AIDS Reagent program catalog no. 288) and 6x-His Tag (ThermoFisher catalog no. MA1-21315-HRP).
-
bioRxiv - Immunology 2021Quote: ... with an N-terminal IL-2 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFUSE-vector (Invitrogen, Thermo Fischer Scientific, MA, USA). The human ACE2 was expressed by essentially the same protocol used for the COVID-19 RBD ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 Spike RBD, His, Avitag™ (ACRO Biosystems, SPD-C82E9) immobilized on paramagnetic beads (Dynabeads M-280 streptavidin; Invitrogen Dynal AS, Oslo, Norway) as target antigen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used the modified pSec-NtermHis6 vector containing secretory signal peptide (IgK Leader) as found originally in commercial vector pSecTag/FRT/V5- His-TOPOR vector (Thermo Fisher Scientific, Waltham, MA, USA), but fused to six histidine residues (His6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed once with 2% HI-FBS S-MEM and further stained with PE-conjugated anti-mouse IgM (Thermo Fisher Scientific, #12-5790-81) for 30 minutes to detect the HTII-280 primary antibody ...
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3% bovine serum albumin (BP1605-100; Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... cells washed 3 times with EBSS (GIBCO BRL, 24,010–043) and replaced with EBSS or Live Cell Imaging Solution (Molecular Probes ...
-
bioRxiv - Immunology 2021Quote: ... and for Calu-3 cells was MEM (Thermo Fisher 11090081) supplemented with GlutaMAX ...