Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Fish Sperm DNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... DNA was depleted using the TURBO DNA-free kit (Invitrogen), repeating the steps in the kit three times to achieve complete depletion ...
-
bioRxiv - Microbiology 2021Quote: ... Contaminating DNA was removed using TURBO DNA-free kit (Invitrogen). RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA polymerase I and DNA ligase (Thermo Fisher Scientific). Sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England BioLabs) ...
-
bioRxiv - Microbiology 2020Quote: ... 3μl of DNA ladder (1 Kb Plus DNA Ladder; Invitrogen), 6 μl of positive control and 10 μl of samples were ran on 1.5% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Trace contaminating DNA was removed with TURBO DNA-free (Ambion). RNA quality control quantification was performed using a Qubit Fluorometer (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was extracted (PureLink Genomic DNA Mini Kit, Invitrogen) from modified cells expression the transgenic and integrated receptor ...
-
bioRxiv - Microbiology 2023Quote: ... followed by DNA sequencing with 3730xl DNA Analyzer (Applied Biosystems). The consensus 16S rRNA gene sequences were searched against validly published bacteria available using the EzBioCloud Database [47] ...
-
bioRxiv - Genetics 2023Quote: ... with DNA lad-der (1 kb Plus DNA Ladder, Invitrogen), 100 ng/µl DNA in total (see Supplemetary Table S1) ...
-
bioRxiv - Genomics 2023Quote: ... DNA concentration was determined with Qubit Broad Range DNA (Invitrogen) fluorometry ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted (GeneJET genomic DNA purification Kit, Thermo Scientific) and the region containing the DNA barcode was amplified with the following PCR reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted using the PureLink Genomic DNA Minikit (Invitrogen) and processed using the IMPACT505 panel as above ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated using PureLink’s genomic DNA extraction kit (Invitrogen) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using Genomic DNA mini kit (Invitrogen) on a pre-PCR bench under sterile conditions to avoid DNA contamination.
-
bioRxiv - Microbiology 2024Quote: ... DNA was removed using the TURBO DNA-freeTM kit (Invitrogen) according to the ‘rigorous treatment’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Carryover DNA was removed with TURBO DNA-free kit (Ambion), and cDNA generated using LunaScript® RT Supermix kit (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA-free (Invitrogen) in mixture with other provided PCR components ...
-
bioRxiv - Cell Biology 2022Quote: ... Remaining genomic DNA contaminations were removed using the DNA-free™ DNA Removal Kit (Ambion, Thermo Scientific, Germany). DNase-treated RNA was transcribed into complementary DNA (cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Remaining genomic DNA contaminations were removed using the DNA-free™ DNA Removal Kit (Ambion, Thermo Scientific, Germany). DNase-treated RNA was transcribed into complementary DNA (cDNA ...
-
bioRxiv - Physiology 2020Quote: ... while total DNA content was measured by PicoGreen DNA Assay (Quant-iT Picogreen DNA kit, Thermo Fisher Scientific).
-
bioRxiv - Genetics 2021Quote: ... RNA was treated with DNA-free™ DNA Removal (Invitrogen™). Reverse transcription was performed with SuperScript Reverse Transcriptase (Invitrogen™ ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was removed using the Turbo DNA-free kit (ThermoFisher). Eukaryotic mRNA was depleted using Dynabeads covalently linked with oligo dT (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was isolated using the PureLink Genomic DNA kit (ThermoFisher). Barcode inserts were then amplified via 25 cycles of PCR and submitted for Amplicon-EZ analysis by Genewiz ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was digested with the TURBO DNA-free Kit (Invitrogen). cDNA was synthesized from 400 ng of RNA using ImProm-II Reverse Transcription system kit and random primers (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... contaminating DNA was removed using the TURBO DNA-free kit (Ambion, Thermo Fisher Science ...
-
bioRxiv - Genomics 2019Quote: ... We resolved DNA-protein complexes on nondenaturing DNA retardation gels (Invitrogen) in 0.5×TBE ...
-
bioRxiv - Plant Biology 2019Quote: ... Genomic DNA was removed using the TURBO DNA-free kit (Ambion). Total RNA samples were sent to BGI Tech ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was removed using a Turbo DNA-free kit (Ambion). cDNA was made using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Physiology 2019Quote: ... with any contaminated DNA eliminated using DNA free removal kit (Invitrogen). Purified RNA was then reverse transcribed using superscript II (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Contaminating genomic DNA was removed using Turbo DNA free from Ambion. RNA concentrations were determined with a spectrophotometer (NanoDrop ...
-
bioRxiv - Biochemistry 2020Quote: DNA was extracted using the PureLink Genomic DNA Mini kit (Invitrogen) for genotyping by PCR using primers P1 5’ CATTACTTTAATTTTTATACTACTGTTTATTTTTACAGTAC 3’ ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA was removed using the TURBO DNA-free kit (Invitrogen, #AM1907) and then RNA was quantified using the QuBit RNA Broad Range detection kit (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... For genotyping of mouse genomic DNA DreamTaq DNA polymerase (ThermoFisher Scientific) was used.
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA was eliminated with the Turbo DNA-free kit (Ambion). cDNA was generated with the AccuScript High Fidelity cDNA kit (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed (TURBO DNA-free Kit; Invitrogen, Carlsbad, CA, USA), and RNA was purified (RNA Clean & Concentrator-5 Kit ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was removed using the TURBO DNA-free kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... DNA contamination was eliminated using the Turbo DNA-free kit (Invitrogen). The MicrobEnrich kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Contaminating DNA was removed using the TURBO DNA-free kit (Ambion, Thermo Fisher Science ...
-
bioRxiv - Genetics 2021Quote: ... DNA was then extracted using PureLink Genomic DNA Mini Kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was purified with a DNA purification kit (Thermo Fisher Scientific) and analyzed with standard PCR conditions ...
-
bioRxiv - Microbiology 2021Quote: ... remaining DNA was digested using the TURBO DNA-free kit (Invitrogen), and the concentration and purity of RNA were measured using a NanoDrop instrument (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was removed using the TURBO DNA-free kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid DNA-TurboFect and plasmid DNA-Lipofectamine 2000 (ThermoFisher Scientific, USA) complexes were prepared following the manufacturer’s protocol in serum-free OptiMEM (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA removed using a TURBO DNA-free™ kit (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: For genotyping of mouse genomic DNA DreamTaq DNA polymerase (ThermoFisher Scientific) was used ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA was eliminated with TURBO DNA-free™ kit (Invitrogen). The cDNA was synthesized from 2 μg of total RNA with SuperiorScript Master mix (Enzynomics) ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was removed using the Turbo DNA-Free kit (Ambion). All samples used for library generation had an RNA integrity number of 7.5 or higher.
-
bioRxiv - Neuroscience 2021Quote: ... Genomic DNA was extracted using PureLink Genomic DNA Mini Kit (Invitrogen). 40X Taqman SNP genotyping assay and custom designed primer-probe set (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA product was self-ligated using T4 DNA ligase (Invitrogen) and transformed to DH5α competent cells ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was removed using the TURBO DNA-free kit (ThermoFisher Scientific ...