Labshake search
Citations for Thermo Fisher :
551 - 600 of 1551 citations for Echovirus Antigen Recombinant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 ng/ml bFGF recombinant human protein (Thermo Fisher Scientific, USA). From day 6 until day 12 the medium was changed once in two days with the addition of 1 mM valproic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The guide RNAs and recombinant Cas9-NLS protein (Thermo Fisher Scientific, B25642) were transfected into HEK293 T-Rex cells with Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The yield of the recombinant protein was estimated by Qubit 2.0 (Invitrogen) and the degree of purification by SDS-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... Human recombinant epidermal growth factor (hEGF) protein was purchased from Life Technologies and dissolved in PBS ...
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... resuspended in water and pre-cleared with recombinant protein G agarose (Invitrogen). Immunoprecipitation of lysates was performed after lysis in NP-40 lysis buffer ...
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen, Waltham, MA) (hiPSC medium).
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Physiology 2020Quote: ... and 2.5 ng/ml recombinant human hepatocyte growth factor (Gibco, Loughborough, UK). Skeletal muscle myoblasts were incubated at 37°C in a humidified atmosphere of 5% CO2 until 80% confluence ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins were acetone precipitated prior to digestion with recombinant trypsin (ThermoFisher) (1:50 wt/wt. ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Human alpha-1 PDX (alpha1-PDX) recombinant protein was purchased from ThermoFisher Scientific.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant proteins were expressed using the Expi293 Expression system (ThermoFisher Scientific) and purified with HisTrap FF columns (for polyhistidine-tagged spike proteins ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 ng/mL Human TGF-β 1 recombinant protein (Cat# PHG9204, Gibco) and 1 μg/mL L-Ascorbic acid 2-phosphate (Cat# A8960 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing recombinant antibody was incubated with protein A resin (ThermoFisher) overnight at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...