Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 6 Chloro 9 fluorobenz 9 isoquinoline 5 10 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: SVG-A and 293T cells were infected with JCPyV M1-SVEΔ for 9-11 days and stained first with the LIVE/DEAD® Fixable Aqua Dead Cell Stain Kit (Invitrogen), then cells were split and stained in parallel with one of the following antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gal-9-Alexa-594 was prepared using DyLight® 594 (DyLight 594 NHS Ester; Piercenet, Thermo Scientific, 46412, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... SLITRK3-E606X-Myc or SLITRK3-C566R-Myc together with pCAGGS-IRES-GFP (SLITRK3:GFP=9:1)) were transfected into cultured hippocampal neurons at DIV 14-15 using Lipofectamine 3000 (ThermoFisher, L3000015). After 48 hours ...
-
bioRxiv - Genetics 2022Quote: ... or SLITRK3-C566R-Myc together with pCAGGS-IRES-GFP (SLITRK3:GFP=9:1) were transfected into cultured hippocampal neurons at DIV 14-15 using Lipofectamine 3000 (ThermoFisher, L3000015). 48 hours after transfection ...
-
bioRxiv - Physiology 2023Quote: ... 9 µl of P3000 reagent and 9 µl of Lipofectamine 3000 prepared in reduced-serum Minimal Essential Medium (Opti-MEM) (Life Technologies). After 24 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... Hippocampi of male and female E17 mouse brains from a single litter (7-9 embryos) were dissected in HBSS (ThermoFisher Scientific) supplemented with 1% L-glutamine ...
-
bioRxiv - Cancer Biology 2023Quote: Nystatin was purchased from MilliporeSigma (Cat. No. 1400-61-9). Mirvana miRNA mimic hsa-miR-421 (Cat. No. 4464066) was purchased from Thermo Scientific, Waltham ...
-
bioRxiv - Cancer Biology 2023Quote: ... each well was transfected via master mix 3 µL of siRNAs (20 µM) via 9 µL Lipofectamine 2000 (Invitrogen, #.11668-019) in 300 µL OPTI-MEM (Gibco ...
-
bioRxiv - Biophysics 2023Quote: We performed the biotinylation of single chain antibodies and of Gal-9 with EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher). For this ...
-
bioRxiv - Neuroscience 2024Quote: Mice were sacrificed at p6-9 and brains were collected in ice-cold Hanks’ Balanced Salt Solution (HBSS, Thermo Fisher Scientific). Cerebellum was isolated and cut into 300 µm-thick sagittal sections (McIlwain tissue chopper ...
-
bioRxiv - Neuroscience 2023Quote: ... larvae were processed as previously described[9] and incubated in primary and secondary antibodies as follows: phalloidin-488 or phalloidin-633 1:100 (Thermo Fisher); αGNAT2 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 μL of the nuclei suspension was mixed with 9 μL of 0.4% Trypan Blue Solution (Thermo Fisher, catalog number: 15250061), and the nuclei count was determined under 20X brightfield microscope using a Chemglass Life Sciences Disposable Hemocytometer (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Pellets from the ultracentrifugation fractions 1 to 9 were resuspended in RIPA buffer with Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific) with sonication in a Biorupter with settings 10x 30s on 30s off at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... at a density of 9×104 cells ml−1 in N2B27 differentiation medium containing Advanced DMEMF12 and Neurobasal media (1:1, Life Technologies), B27 w/o vitamin A (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Microbiology 2020Quote: Nuclear extract from 293T cells expressing ETV7 and treated with IFN-α (100 U/mL, 9 h) was generated using NE-PER extraction reagents (Thermo Scientific). This nuclear extract was incubated with poly(dI-dC ...
-
bioRxiv - Developmental Biology 2021Quote: Protein was extracted from approximately 50mg of placental Jz tissue (n = 7 per genotype/sex, across 9 litters) using RIPA buffer (Thermo Scientific, US) containing cOmplete Mini EDTA-free protease inhibitor cocktail mix (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... was dissolved in 0.9% physiological saline (Medical Mart, Mississauga, ON) and filtered with Corning bottle-top filters (0.22 μm PES membrane; Fisher Scientific, Whitby, ON).
-
bioRxiv - Genomics 2020Quote: ... We extracted DNA with 0.9 mL Extraction Buffer (1% SDS [Fisher Scientific], 240 mg/L para-aminosalicyclic acid [ACROS], 484 mg/L Tris/HCl [Fisher Scientific] ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Biochemistry 2019Quote: The N30 Random DNA pool and cDNA from rounds 7-to-9 were cloned into TOPO™ TA Cloning™ Kit (Invitrogen) following manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2020Quote: Mice were physically restrained for 60 min in 50-ml polypropylene centrifuge tubes with 9 air holes of 3-mm diameter (339652, Thermo Fisher Scientific) (single exposure to restraint stress ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transfected with 3.5 µg of each CAS-9-guide and EGFP donor knock-in vector using Lipofectamine 2000 (11668019, Invitrogen, Thermo Fisher Scientific) for 6 hours before replacing media to allow cells to recover ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from 6-9 mice per group as biological replicates for validation of RNA-seq cDNA was prepared with random hexamer primers (Invitrogen, Ottawa, ON) and a reverse transcription kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... the total RNA from cytoplasmic lysates (Inputs) and polysome-bound RNA from the polysomal fraction 9 were extracted using trizol (Thermo Fisher Scientific), isopropanol precipitated ...
-
bioRxiv - Molecular Biology 2022Quote: For all proteomic analysis, HMI-9 SILAC medium (Urbaniak, Martin, and Ferguson 2013)-L-Arginine and – L-Lysine (Gibco, reference 074-91211A) was used ...
-
bioRxiv - Cell Biology 2021Quote: The tomograms showed in the Figure 8 and 9 were performed on Glacios equipped with a field emission gun and operated at 200 kV (Thermo Fisher Scientific) and a Falcon 3 direct electron detector ...
-
bioRxiv - Microbiology 2020Quote: ... A 1 µl aliquot of the washed and diluted cell suspension was added to a 9 µl droplet on a glass slide treated with RNase AWAY® Reagent (Life Technologies) and UV light ...
-
bioRxiv - Systems Biology 2020Quote: We cultured GM11169 human cardiac fibroblasts (Coriell, GM11169; XX donor) on tissue culture-treated dishes in DMEM w/Glutamax + 9% FBS (Life Technologies 16000044) + P/S.
-
bioRxiv - Cell Biology 2019Quote: ... at a 1:9 ratio (ng of DNA) using Lipofectamine 2000 prior to selection using 200 μg/ml of Hygromycin B (Thermo Fisher Scientific) for positive clones ...
-
bioRxiv - Genomics 2019Quote: ... and wild type (n = 9) mice were determined using a Countess Automated Cell Counter according to manufacturer’s protocol (Life Technologies, Carlsbad, CA). For the Tug1rescue experiment ...
-
bioRxiv - Microbiology 2019Quote: ... JE-CVax hyper-immune and non-immune heat inactivated mouse serum samples (starting dilution of 1/9) were serially diluted 3-folds in RPMI 1640 medium (Gibco, ThermoFisher Scientific) supplemented with 4% low IgG serum ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1-10 ng template in 9 μl Nuclease-free water were added to 10.0 μL of 2× TaqMan® Universal PCR master mix (ABI/Life technologies, USA) and 1.0 μL of a 20× combined primers and probes mix (ABI/Life Technologies ...
-
bioRxiv - Pathology 2020Quote: ... as previously described (9) with a difference that the measurement was carried out on a TSQ Access Max triple quadrupole (Thermo Scientific, USA) operating in positive SRM mode ...
-
bioRxiv - Molecular Biology 2021Quote: ... was dissolved in 9 ml of deionized water and 1ml of 10x Pierce™ Stable Peroxide Substrate Buffer (Thermo Fisher, Scientific, 34062). 100 μl of OPD substrate solution were added per well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... These sequences were cloned into pENTR plasmid vector followed by recombination with piggyBac vector [9] using Gateway LR Clonase II Enzyme Mix (11791-020, Thermo Fisher Scientific). The piggyBac vector and transposon vector were kind gifts from Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... Totally around 50,000 cells were plated as thin-layer culture onto poly-L-ornithine coated circular cover glasses (9 mm of diameter, Thermo Fisher Scientific). Co-cultures were cultured 5 weeks in neurosphere medium (NSM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The extent of reaction completion was monitored by the strong anion exchange chromatography on a Pro Pac PA1 column (9×250 mm, Thermo Fisher Scientific) by measuring the absorbance at 232 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... then subsequently stained with 1 uL SYTO 9 (for DNA) and 1 uL BacLight Red (for cell wall) Bacterial Stain Ex581/Em644 (Invitrogen, Thermo Fisher, UK). For mounting ...
-
bioRxiv - Microbiology 2020Quote: ... A 1 μl aliquot of the washed and diluted cell suspension was added to a 9 μl droplet on a glass slide treated with RNase AWAY® Reagent (Life Technologies) and UV light ...
-
bioRxiv - Biochemistry 2022Quote: ... Mixed peptide samples were prepared from 9 μL of each sample and separated using a high pH reversed-phase peptide separation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Dried RNA from stage embryos was resuspended in 9 µL nuclease-free water and 1 µL used for quantification by NanoDrop™ One/OneC spectrophotometer (Thermo Scientific). The remaining RNA (< 3 µg ...
-
bioRxiv - Neuroscience 2022Quote: ... packed in-house with ReproSil-Pur 120 C18-AQ 1.9-micron beads (Dr. Maisch GmbH Cat#r119.aq)) via the autosampler of the Thermo Scientific Easy-nLC 1200 (Thermo Fisher Scientific) at 60°C ...
-
bioRxiv - Neuroscience 2023Quote: ... at 60 μm from frontal cortex to posterior striatum and then dried and cover slipped under glycerol:TBS (9:1) with Hoechst 33342 (2.5 μg/ml, Thermo Fisher Scientific, Waltham, MA). Sections were imaged on an Olympus VS120 slide scanning microscope (Olympus Scientific Solutions Americas ...
-
bioRxiv - Immunology 2023Quote: ... Flow cytometry was performed using a Myltenyi VYB cytometer with MEM-G/9 antibody (anti-HLA-G antibody ; Thermo Fisher #MA1-19014), 3D12 (anti-HLA-E antibody ...
-
bioRxiv - Biophysics 2023Quote: ... we cryogenically stored the skin samples from each group at −80 °C in a 9:1 ratio of DMEM:DMSO with protease inhibitor (ThermoFisher, A32953, Weltham, MA) until assayed ...